ID: 985685914

View in Genome Browser
Species Human (GRCh38)
Location 5:1281398-1281420
Sequence TGCACACTCGAGTCCCTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 117}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985685914 Original CRISPR TGCACACTCGAGTCCCTGGG GGG (reversed) Intronic
900599482 1:3496948-3496970 AGCACTGCCGAGTCCCTGGGTGG + Intronic
900685424 1:3945063-3945085 TTCCCTCTGGAGTCCCTGGGGGG + Intergenic
901481427 1:9527910-9527932 TGGACTCTCCAGTTCCTGGGTGG - Intergenic
904863497 1:33558214-33558236 TGAACACACGAGTCCCTTGAGGG + Intronic
904924215 1:34033557-34033579 TGCACAATCAGGTCCCTGTGAGG - Intronic
906701352 1:47860469-47860491 AGCAGACTCAAGCCCCTGGGTGG - Intronic
911362374 1:96894732-96894754 AGCACACTCTAATGCCTGGGAGG - Intergenic
911445078 1:97982429-97982451 TGCACACTGGAATCACTGGGAGG + Intergenic
912864886 1:113248124-113248146 TGGACTCTGGAGTCCCTGGAGGG + Intergenic
913971767 1:143422176-143422198 TGCATACTGGTGTCCCTGGCTGG - Intergenic
914066146 1:144247789-144247811 TGCATACTGGTGTCCCTGGCTGG - Intergenic
914113007 1:144718565-144718587 TGCATACTGGTGTCCCTGGCTGG + Intergenic
914702518 1:150148154-150148176 TGCACACTCATGCCCATGGGAGG + Intergenic
916994779 1:170284720-170284742 GGCACACTTGAGACCCTGGGAGG - Intergenic
1063262288 10:4403508-4403530 TGCAAACTCTACTCCTTGGGAGG - Intergenic
1066107543 10:32169016-32169038 TGCAGCCTCGAAACCCTGGGAGG + Intergenic
1072020697 10:91396311-91396333 TTCATACTAGAGTCCCTGAGTGG - Intergenic
1072618678 10:97066072-97066094 TTCTCACTCAAGTCCCTGGGAGG + Exonic
1074866353 10:117546386-117546408 TGCACAGCAGGGTCCCTGGGCGG + Intronic
1077308106 11:1876855-1876877 TGCATACTGGTGTCCCTGGCTGG + Intronic
1081243781 11:40738303-40738325 TGCAAACTGAAGACCCTGGGAGG - Intronic
1084848693 11:71921061-71921083 TGCAGCCTCAAATCCCTGGGAGG + Intronic
1085525712 11:77162351-77162373 TGCGCACCCAAGACCCTGGGAGG - Intronic
1090835157 11:130448800-130448822 TGCACGCTCGCCGCCCTGGGAGG + Intergenic
1093828947 12:23731266-23731288 TGCAAGCTGGAGACCCTGGGAGG - Intronic
1094100091 12:26752802-26752824 TCCTCACTCTAGTCCCTTGGTGG - Intronic
1097009692 12:55943592-55943614 TGCACACTCAAATACCTGAGTGG - Intronic
1098010557 12:66046223-66046245 TGAACACAGGACTCCCTGGGTGG - Intergenic
1100764528 12:97849044-97849066 TGCCCAGTCTAGCCCCTGGGTGG - Intergenic
1102617403 12:114166497-114166519 AGGACACTCGAGTTCTTGGGTGG + Intergenic
1105715429 13:23057801-23057823 TGGGCACTCCAGCCCCTGGGTGG + Intergenic
1107826181 13:44330919-44330941 TGCACTCTCACCTCCCTGGGAGG - Intergenic
1111763226 13:92493051-92493073 TGCACACTCAGGGCCCTGGAAGG - Intronic
1113208163 13:107941665-107941687 TCCACACTCCAGACCCTGGAGGG - Intergenic
1113336805 13:109384336-109384358 TGCAGACTCCAGTCCATGTGAGG + Intergenic
1120228984 14:81822439-81822461 TGCACACCTGTGTCCCTGGCTGG + Intergenic
1121319320 14:92981833-92981855 TGCACACTCCCTTCCCTGCGTGG - Intronic
1122505583 14:102229824-102229846 TGCCCACTAGAGTCCCACGGGGG + Intronic
1131536435 15:93241476-93241498 TGCACAGTAGAGTCAGTGGGGGG + Intergenic
1132833512 16:1941328-1941350 TGCACACTCGTCTCCATGGCCGG - Exonic
1137652038 16:50128942-50128964 TGCAAACTGGAGACCCTGGAAGG + Intergenic
1140405852 16:74710948-74710970 TGCACTCTCAAGTCCCTGTGAGG + Intergenic
1144010595 17:11144875-11144897 TTCAAACTTGAGTCTCTGGGAGG + Intergenic
1144067793 17:11640124-11640146 AGCACACTGGAGTTCCTGGGGGG - Intronic
1148046578 17:44748593-44748615 TGGACACTGGTATCCCTGGGGGG - Intronic
1149894819 17:60421633-60421655 CGCCCCCTCGCGTCCCTGGGCGG - Intronic
1150744089 17:67802330-67802352 TGCAGACTGGAGACCCTGGGAGG + Intergenic
1152741132 17:82018935-82018957 TGCACACTATTGTCCCAGGGAGG + Exonic
1152810306 17:82378715-82378737 TGAAGACTCGAGTCCCAGGAGGG + Intergenic
1153688478 18:7568193-7568215 TGCACTCTTGAGTCCCTGGCCGG + Intronic
1157812525 18:50707763-50707785 TGGACACTCCAGGCCCTGTGTGG - Intronic
1160962561 19:1730038-1730060 TGCACACGGGAGGCCCTCGGGGG + Intergenic
1165158296 19:33801441-33801463 TGCACCCTGGAGACCCTGGTGGG - Intronic
1167433265 19:49465132-49465154 TGCTCCCTTGAGTCTCTGGGGGG - Intronic
927330445 2:21856526-21856548 TGCACTCTCCAGTCCCTTTGGGG + Intergenic
933602570 2:84347949-84347971 AACACACTAGAATCCCTGGGTGG - Intergenic
934176457 2:89583108-89583130 TGCATACTGGTGTCCCTGGCTGG - Intergenic
934286767 2:91657469-91657491 TGCATACTGGTGTCCCTGGCTGG - Intergenic
936948406 2:117952157-117952179 TGCACATTCTAGTCCCTTAGTGG - Intronic
941308399 2:163898442-163898464 TGGACTCTTGAGTTCCTGGGTGG - Intergenic
942719430 2:178934113-178934135 TGCACACTGGAGTCACCTGGGGG - Intronic
948663966 2:239523239-239523261 TGCACCCTCGTGGCCCTGGCGGG - Intergenic
1169096857 20:2908449-2908471 TGCACACTCAAGTCCCACAGTGG - Intronic
1170392393 20:15889793-15889815 TGCACAGTTGAGTCCCTCAGGGG + Intronic
1170464954 20:16614045-16614067 TGAGCATTCAAGTCCCTGGGGGG + Intergenic
1175384721 20:58586947-58586969 TGCAGACTCCAGACCCGGGGAGG - Intergenic
1175942704 20:62545317-62545339 TGCACACTCGACTCACTGAGTGG + Intergenic
1179117094 21:38503471-38503493 TGCCCACTGGAGTTCCTGGCAGG - Intronic
1182145227 22:27993286-27993308 AGCACACTCCAGTCCCTGCTGGG - Exonic
1183363321 22:37394284-37394306 GGCACACTAGAGACCCTGGGAGG - Intronic
1184807770 22:46806811-46806833 TACCCACTCCAGACCCTGGGTGG - Intronic
952002997 3:28808665-28808687 AGCACAGTCCAGTCGCTGGGTGG - Intergenic
955737146 3:62051375-62051397 TGCACAATCATGTCACTGGGAGG - Intronic
955867608 3:63401554-63401576 TGCACACTGGCTGCCCTGGGAGG + Intronic
959533640 3:107461615-107461637 TAAACACTTGAGACCCTGGGGGG - Intergenic
961336694 3:126184589-126184611 TGCACACTGCTTTCCCTGGGAGG - Intronic
961474530 3:127138446-127138468 TGCACACTCTAATCCCTTGGTGG + Intergenic
964708457 3:159646319-159646341 TGCTCACTAGAGGCTCTGGGAGG - Intronic
965297582 3:166969363-166969385 AGCACACTCATGTCCCTGGAGGG - Intergenic
965987747 3:174776484-174776506 TACTCTATCGAGTCCCTGGGTGG + Intronic
968487795 4:872291-872313 TGCCCACTCAAGGCTCTGGGCGG + Intronic
969339550 4:6531493-6531515 TGCTCCCTCAAGTCCCTTGGAGG - Intronic
969764390 4:9216911-9216933 GGCACACTCGCTTCCCTGCGAGG + Exonic
969764994 4:9221658-9221680 GGCACACTCGCTTCCCTGCGAGG + Exonic
969765604 4:9226402-9226424 GGCACACTCGCTTCCCTGCGAGG + Exonic
969766214 4:9231147-9231169 GGCACACTCGCTTCCCTGCGAGG + Intergenic
969766827 4:9235891-9235913 GGCACACTCGCTTCCCTGCGAGG + Exonic
969767436 4:9240636-9240658 GGCACACTCGCTTCCCTGCGAGG + Intronic
969768044 4:9245385-9245407 GGCACACTCGCTTCCCTGCGAGG + Exonic
969768647 4:9250136-9250158 GGCACACTCGCTTCCCTGCGAGG + Exonic
969769251 4:9254884-9254906 GGCACACTCGCTTCCCTGCGAGG + Exonic
969769867 4:9259630-9259652 GGCACACTCGCTTCCCTGCGAGG + Exonic
969770472 4:9264378-9264400 GGCACACTCGCTTCCCTGCGAGG + Exonic
969771087 4:9269125-9269147 GGCACACTCGCTTCCCTGCGAGG + Exonic
969772069 4:9326671-9326693 GGCACACTCGCTTCCCTGCGAGG + Exonic
969772685 4:9331417-9331439 GGCACACTCGCTTCCCTGCGAGG + Exonic
969773302 4:9336164-9336186 GGCACACTCGCTTCCCTGCGAGG + Exonic
969773917 4:9340909-9340931 GGCACACTCGCTTCCCTGCGAGG + Exonic
969774532 4:9345654-9345676 GGCACACTCGCTTCCCTGCGAGG + Exonic
969775147 4:9350399-9350421 GGCACACTCGCTTCCCTGCGAGG + Exonic
969775762 4:9355144-9355166 GGCACACTCGCTTCCCTGCGAGG + Exonic
969776373 4:9359889-9359911 GGCACACTCGCTTCCCTGCGAGG + Intronic
969776991 4:9364635-9364657 GGCACACTCGCTTCCCTGCGAGG + Exonic
985685914 5:1281398-1281420 TGCACACTCGAGTCCCTGGGGGG - Intronic
989145533 5:38245890-38245912 TGCACATTCGAATCACTTGGGGG - Intergenic
990230897 5:53712235-53712257 TGCACTCTGGAGAACCTGGGGGG - Intergenic
995374401 5:111457993-111458015 TGCACACTAGGGTTCCTGTGTGG + Intronic
999199147 5:149803863-149803885 TGCAGACTCGAGGCTCTGGCTGG - Intronic
1001685731 5:173593570-173593592 TGCACCCTAGAGGCCCTGCGGGG - Intergenic
1002915887 6:1527372-1527394 TGCAGACTCAAGTCCCAAGGTGG + Intergenic
1003042452 6:2700601-2700623 TCCACACACGTATCCCTGGGTGG - Intronic
1003917556 6:10801445-10801467 TGCACACTCCAGTCCCAGCAAGG + Intronic
1006814405 6:36840375-36840397 TCCACACCCAAGCCCCTGGGAGG - Intergenic
1013334673 6:109143744-109143766 TACACACTGAAGTCCTTGGGAGG - Intronic
1029958269 7:104662387-104662409 TGCATACTTGGGTCCTTGGGGGG - Intronic
1035453174 7:158992353-158992375 TGCAGATTCCAGTCCCTGCGGGG + Intergenic
1037226749 8:16602041-16602063 TGCCCACTAGGGTCTCTGGGTGG - Intergenic
1038534641 8:28345032-28345054 TGCACAAACCAGCCCCTGGGTGG + Intergenic
1040014536 8:42689875-42689897 TGCACACTTCAGCCCTTGGGTGG - Intergenic
1041203183 8:55471492-55471514 TGAACACCAGAATCCCTGGGAGG - Intronic
1046062077 8:109151730-109151752 TACACACTTATGTCCCTGGGAGG + Intergenic
1049844505 8:144793342-144793364 AGCACACGCGAGGCCGTGGGTGG + Intergenic
1054782732 9:69180558-69180580 AGCACACCTGAGACCCTGGGTGG + Intronic
1060796378 9:126515133-126515155 TGCTCCCTCCAGTCCCTGGCTGG + Intergenic
1062202407 9:135310493-135310515 TGCAAACTCCAGGACCTGGGGGG - Intergenic
1062582715 9:137235581-137235603 TGCACAGTCCAGGCCCTGCGGGG - Intronic
1197796632 X:130305349-130305371 TTCACACCCAAGTCCCTGTGGGG + Intergenic
1200015652 X:153160687-153160709 TGCAAGCTGGAGACCCTGGGAGG - Intergenic