ID: 985690137

View in Genome Browser
Species Human (GRCh38)
Location 5:1304322-1304344
Sequence AAGAAGAAGGAGAAGGAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985690137_985690145 11 Left 985690137 5:1304322-1304344 CCCTTCTCCTTCTCCTTCTTCTT No data
Right 985690145 5:1304356-1304378 TCTTGTTCTGTTGTCTAGGCTGG No data
985690137_985690144 7 Left 985690137 5:1304322-1304344 CCCTTCTCCTTCTCCTTCTTCTT No data
Right 985690144 5:1304352-1304374 GGGGTCTTGTTCTGTTGTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985690137 Original CRISPR AAGAAGAAGGAGAAGGAGAA GGG (reversed) Intergenic
No off target data available for this crispr