ID: 985690783

View in Genome Browser
Species Human (GRCh38)
Location 5:1311068-1311090
Sequence GCCCAGGTACAGAATCTTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985690775_985690783 15 Left 985690775 5:1311030-1311052 CCACAGAGTGGGAGTGGGCTCAA 0: 3
1: 19
2: 60
3: 125
4: 402
Right 985690783 5:1311068-1311090 GCCCAGGTACAGAATCTTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985690783 Original CRISPR GCCCAGGTACAGAATCTTGG GGG Intergenic
No off target data available for this crispr