ID: 985690879

View in Genome Browser
Species Human (GRCh38)
Location 5:1311607-1311629
Sequence ACCTGTGGGGAGCCCTGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985690879_985690890 13 Left 985690879 5:1311607-1311629 CCAGGGCAGGGCTCCCCACAGGT No data
Right 985690890 5:1311643-1311665 CGGGGCTGCTCCTGCCAGGCAGG No data
985690879_985690891 14 Left 985690879 5:1311607-1311629 CCAGGGCAGGGCTCCCCACAGGT No data
Right 985690891 5:1311644-1311666 GGGGCTGCTCCTGCCAGGCAGGG No data
985690879_985690883 -7 Left 985690879 5:1311607-1311629 CCAGGGCAGGGCTCCCCACAGGT No data
Right 985690883 5:1311623-1311645 CACAGGTGTTGTGACAGCCCCGG No data
985690879_985690885 -5 Left 985690879 5:1311607-1311629 CCAGGGCAGGGCTCCCCACAGGT No data
Right 985690885 5:1311625-1311647 CAGGTGTTGTGACAGCCCCGGGG No data
985690879_985690895 28 Left 985690879 5:1311607-1311629 CCAGGGCAGGGCTCCCCACAGGT No data
Right 985690895 5:1311658-1311680 CAGGCAGGGCTCCTCATAGGTGG No data
985690879_985690893 25 Left 985690879 5:1311607-1311629 CCAGGGCAGGGCTCCCCACAGGT No data
Right 985690893 5:1311655-1311677 TGCCAGGCAGGGCTCCTCATAGG No data
985690879_985690886 9 Left 985690879 5:1311607-1311629 CCAGGGCAGGGCTCCCCACAGGT No data
Right 985690886 5:1311639-1311661 GCCCCGGGGCTGCTCCTGCCAGG No data
985690879_985690884 -6 Left 985690879 5:1311607-1311629 CCAGGGCAGGGCTCCCCACAGGT No data
Right 985690884 5:1311624-1311646 ACAGGTGTTGTGACAGCCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985690879 Original CRISPR ACCTGTGGGGAGCCCTGCCC TGG (reversed) Intergenic