ID: 985691113

View in Genome Browser
Species Human (GRCh38)
Location 5:1313120-1313142
Sequence TGCCGTGGCCACGGACGGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985691113_985691120 16 Left 985691113 5:1313120-1313142 CCTCACCGTCCGTGGCCACGGCA No data
Right 985691120 5:1313159-1313181 CCTGCACAATCAGCTCTGCAAGG No data
985691113_985691121 25 Left 985691113 5:1313120-1313142 CCTCACCGTCCGTGGCCACGGCA No data
Right 985691121 5:1313168-1313190 TCAGCTCTGCAAGGTGTGATTGG No data
985691113_985691122 28 Left 985691113 5:1313120-1313142 CCTCACCGTCCGTGGCCACGGCA No data
Right 985691122 5:1313171-1313193 GCTCTGCAAGGTGTGATTGGAGG No data
985691113_985691123 29 Left 985691113 5:1313120-1313142 CCTCACCGTCCGTGGCCACGGCA No data
Right 985691123 5:1313172-1313194 CTCTGCAAGGTGTGATTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985691113 Original CRISPR TGCCGTGGCCACGGACGGTG AGG (reversed) Intergenic
No off target data available for this crispr