ID: 985691120

View in Genome Browser
Species Human (GRCh38)
Location 5:1313159-1313181
Sequence CCTGCACAATCAGCTCTGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985691113_985691120 16 Left 985691113 5:1313120-1313142 CCTCACCGTCCGTGGCCACGGCA No data
Right 985691120 5:1313159-1313181 CCTGCACAATCAGCTCTGCAAGG No data
985691114_985691120 11 Left 985691114 5:1313125-1313147 CCGTCCGTGGCCACGGCAGCTTC No data
Right 985691120 5:1313159-1313181 CCTGCACAATCAGCTCTGCAAGG No data
985691116_985691120 1 Left 985691116 5:1313135-1313157 CCACGGCAGCTTCAGTGAGCCAG No data
Right 985691120 5:1313159-1313181 CCTGCACAATCAGCTCTGCAAGG No data
985691115_985691120 7 Left 985691115 5:1313129-1313151 CCGTGGCCACGGCAGCTTCAGTG No data
Right 985691120 5:1313159-1313181 CCTGCACAATCAGCTCTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985691120 Original CRISPR CCTGCACAATCAGCTCTGCA AGG Intergenic
No off target data available for this crispr