ID: 985691121

View in Genome Browser
Species Human (GRCh38)
Location 5:1313168-1313190
Sequence TCAGCTCTGCAAGGTGTGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985691114_985691121 20 Left 985691114 5:1313125-1313147 CCGTCCGTGGCCACGGCAGCTTC No data
Right 985691121 5:1313168-1313190 TCAGCTCTGCAAGGTGTGATTGG No data
985691117_985691121 -9 Left 985691117 5:1313154-1313176 CCAGCCCTGCACAATCAGCTCTG No data
Right 985691121 5:1313168-1313190 TCAGCTCTGCAAGGTGTGATTGG No data
985691115_985691121 16 Left 985691115 5:1313129-1313151 CCGTGGCCACGGCAGCTTCAGTG No data
Right 985691121 5:1313168-1313190 TCAGCTCTGCAAGGTGTGATTGG No data
985691116_985691121 10 Left 985691116 5:1313135-1313157 CCACGGCAGCTTCAGTGAGCCAG No data
Right 985691121 5:1313168-1313190 TCAGCTCTGCAAGGTGTGATTGG No data
985691113_985691121 25 Left 985691113 5:1313120-1313142 CCTCACCGTCCGTGGCCACGGCA No data
Right 985691121 5:1313168-1313190 TCAGCTCTGCAAGGTGTGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985691121 Original CRISPR TCAGCTCTGCAAGGTGTGAT TGG Intergenic
No off target data available for this crispr