ID: 985694073

View in Genome Browser
Species Human (GRCh38)
Location 5:1330146-1330168
Sequence TCCCGATGGCCTCAGTGTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 135}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985694073_985694080 17 Left 985694073 5:1330146-1330168 CCAGAACACTGAGGCCATCGGGA 0: 1
1: 0
2: 1
3: 6
4: 135
Right 985694080 5:1330186-1330208 CACAGAAGGTCTCAGGTCCCGGG 0: 1
1: 0
2: 4
3: 32
4: 300
985694073_985694074 -10 Left 985694073 5:1330146-1330168 CCAGAACACTGAGGCCATCGGGA 0: 1
1: 0
2: 1
3: 6
4: 135
Right 985694074 5:1330159-1330181 GCCATCGGGAACAAGCACACAGG 0: 1
1: 0
2: 0
3: 7
4: 74
985694073_985694081 18 Left 985694073 5:1330146-1330168 CCAGAACACTGAGGCCATCGGGA 0: 1
1: 0
2: 1
3: 6
4: 135
Right 985694081 5:1330187-1330209 ACAGAAGGTCTCAGGTCCCGGGG 0: 1
1: 0
2: 0
3: 7
4: 81
985694073_985694077 10 Left 985694073 5:1330146-1330168 CCAGAACACTGAGGCCATCGGGA 0: 1
1: 0
2: 1
3: 6
4: 135
Right 985694077 5:1330179-1330201 AGGCTTCCACAGAAGGTCTCAGG 0: 1
1: 0
2: 2
3: 18
4: 186
985694073_985694079 16 Left 985694073 5:1330146-1330168 CCAGAACACTGAGGCCATCGGGA 0: 1
1: 0
2: 1
3: 6
4: 135
Right 985694079 5:1330185-1330207 CCACAGAAGGTCTCAGGTCCCGG 0: 1
1: 0
2: 0
3: 17
4: 206
985694073_985694076 3 Left 985694073 5:1330146-1330168 CCAGAACACTGAGGCCATCGGGA 0: 1
1: 0
2: 1
3: 6
4: 135
Right 985694076 5:1330172-1330194 AGCACACAGGCTTCCACAGAAGG 0: 1
1: 0
2: 3
3: 23
4: 260

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985694073 Original CRISPR TCCCGATGGCCTCAGTGTTC TGG (reversed) Intronic