ID: 985696452

View in Genome Browser
Species Human (GRCh38)
Location 5:1343588-1343610
Sequence TTCTGGCCTCCCCTTCATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985696448_985696452 4 Left 985696448 5:1343561-1343583 CCGAGCGGGCAGCTTGGTCACCA 0: 1
1: 0
2: 0
3: 6
4: 80
Right 985696452 5:1343588-1343610 TTCTGGCCTCCCCTTCATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985696452 Original CRISPR TTCTGGCCTCCCCTTCATGG AGG Intronic
No off target data available for this crispr