ID: 985698500

View in Genome Browser
Species Human (GRCh38)
Location 5:1356732-1356754
Sequence GTACAATCCTGGTGTATACG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985698490_985698500 10 Left 985698490 5:1356699-1356721 CCGAAACTAAGAGGAGAAAGGCG No data
Right 985698500 5:1356732-1356754 GTACAATCCTGGTGTATACGGGG No data
985698489_985698500 11 Left 985698489 5:1356698-1356720 CCCGAAACTAAGAGGAGAAAGGC No data
Right 985698500 5:1356732-1356754 GTACAATCCTGGTGTATACGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985698500 Original CRISPR GTACAATCCTGGTGTATACG GGG Intergenic
No off target data available for this crispr