ID: 985699329

View in Genome Browser
Species Human (GRCh38)
Location 5:1361093-1361115
Sequence CCCTAGGGCTCCCCAGCTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985699329_985699341 5 Left 985699329 5:1361093-1361115 CCAGAAGCTGGGGAGCCCTAGGG No data
Right 985699341 5:1361121-1361143 GAGGGCAGAGGGCAGGAGGAGGG No data
985699329_985699344 30 Left 985699329 5:1361093-1361115 CCAGAAGCTGGGGAGCCCTAGGG No data
Right 985699344 5:1361146-1361168 TGGTTAATGGTGTCCAATGCAGG No data
985699329_985699342 10 Left 985699329 5:1361093-1361115 CCAGAAGCTGGGGAGCCCTAGGG No data
Right 985699342 5:1361126-1361148 CAGAGGGCAGGAGGAGGGTGTGG No data
985699329_985699343 17 Left 985699329 5:1361093-1361115 CCAGAAGCTGGGGAGCCCTAGGG No data
Right 985699343 5:1361133-1361155 CAGGAGGAGGGTGTGGTTAATGG No data
985699329_985699338 -2 Left 985699329 5:1361093-1361115 CCAGAAGCTGGGGAGCCCTAGGG No data
Right 985699338 5:1361114-1361136 GGGTTTTGAGGGCAGAGGGCAGG No data
985699329_985699336 -7 Left 985699329 5:1361093-1361115 CCAGAAGCTGGGGAGCCCTAGGG No data
Right 985699336 5:1361109-1361131 CCTAGGGGTTTTGAGGGCAGAGG No data
985699329_985699339 1 Left 985699329 5:1361093-1361115 CCAGAAGCTGGGGAGCCCTAGGG No data
Right 985699339 5:1361117-1361139 TTTTGAGGGCAGAGGGCAGGAGG No data
985699329_985699337 -6 Left 985699329 5:1361093-1361115 CCAGAAGCTGGGGAGCCCTAGGG No data
Right 985699337 5:1361110-1361132 CTAGGGGTTTTGAGGGCAGAGGG No data
985699329_985699340 4 Left 985699329 5:1361093-1361115 CCAGAAGCTGGGGAGCCCTAGGG No data
Right 985699340 5:1361120-1361142 TGAGGGCAGAGGGCAGGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985699329 Original CRISPR CCCTAGGGCTCCCCAGCTTC TGG (reversed) Intergenic
No off target data available for this crispr