ID: 985699337

View in Genome Browser
Species Human (GRCh38)
Location 5:1361110-1361132
Sequence CTAGGGGTTTTGAGGGCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985699324_985699337 15 Left 985699324 5:1361072-1361094 CCACACGCAGGGATTGGGGGACC No data
Right 985699337 5:1361110-1361132 CTAGGGGTTTTGAGGGCAGAGGG No data
985699329_985699337 -6 Left 985699329 5:1361093-1361115 CCAGAAGCTGGGGAGCCCTAGGG No data
Right 985699337 5:1361110-1361132 CTAGGGGTTTTGAGGGCAGAGGG No data
985699319_985699337 23 Left 985699319 5:1361064-1361086 CCAGACATCCACACGCAGGGATT No data
Right 985699337 5:1361110-1361132 CTAGGGGTTTTGAGGGCAGAGGG No data
985699318_985699337 24 Left 985699318 5:1361063-1361085 CCCAGACATCCACACGCAGGGAT No data
Right 985699337 5:1361110-1361132 CTAGGGGTTTTGAGGGCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985699337 Original CRISPR CTAGGGGTTTTGAGGGCAGA GGG Intergenic
No off target data available for this crispr