ID: 985699866

View in Genome Browser
Species Human (GRCh38)
Location 5:1364320-1364342
Sequence TTGTGCACAAAATTTCACAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 263
Summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 227}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985699866_985699872 29 Left 985699866 5:1364320-1364342 CCTTTGTGAAATTTTGTGCACAA 0: 1
1: 0
2: 2
3: 33
4: 227
Right 985699872 5:1364372-1364394 GGCTGTGTCCTGGCCAGTGTCGG 0: 1
1: 0
2: 3
3: 38
4: 308
985699866_985699870 8 Left 985699866 5:1364320-1364342 CCTTTGTGAAATTTTGTGCACAA 0: 1
1: 0
2: 2
3: 33
4: 227
Right 985699870 5:1364351-1364373 GAACACTGCTGTGAGAGAGAGGG 0: 1
1: 0
2: 3
3: 29
4: 291
985699866_985699871 19 Left 985699866 5:1364320-1364342 CCTTTGTGAAATTTTGTGCACAA 0: 1
1: 0
2: 2
3: 33
4: 227
Right 985699871 5:1364362-1364384 TGAGAGAGAGGGCTGTGTCCTGG 0: 1
1: 0
2: 5
3: 35
4: 374
985699866_985699869 7 Left 985699866 5:1364320-1364342 CCTTTGTGAAATTTTGTGCACAA 0: 1
1: 0
2: 2
3: 33
4: 227
Right 985699869 5:1364350-1364372 GGAACACTGCTGTGAGAGAGAGG 0: 1
1: 0
2: 0
3: 20
4: 279

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985699866 Original CRISPR TTGTGCACAAAATTTCACAA AGG (reversed) Intergenic
901353576 1:8621532-8621554 TTATACACAAAATTTCACCACGG + Intronic
905610665 1:39348066-39348088 TTTTGCACAACATTTAATAAAGG - Intronic
906524975 1:46488644-46488666 TTGAGCTGAAAATTGCACAAGGG + Intergenic
907088028 1:51696345-51696367 TTGCCAACAAAATTTCACAAAGG + Intronic
908725343 1:67170083-67170105 TTGGCCTCAAAATTTCTCAATGG - Intronic
910382913 1:86648757-86648779 TTGTTCATAAAATTTAAAAATGG - Intergenic
911375927 1:97051592-97051614 TTGTACACAAAAGTTCATAGCGG + Intergenic
912369437 1:109162161-109162183 TTCTGCACCAAATCTCATAAGGG - Intronic
913659876 1:120997395-120997417 TTGAGCAGAAAATATCCCAAAGG + Intergenic
914011234 1:143780546-143780568 TTGAGCAGAAAATATCCCAAAGG + Intergenic
914166600 1:145180590-145180612 TTGAGCAGAAAATATCCCAAAGG - Intergenic
914649857 1:149689185-149689207 TTGAGCAGAAAATATCCCAAAGG + Intergenic
916073237 1:161184186-161184208 TTTTGCACAAATTTACAAAATGG + Intergenic
916660110 1:166915726-166915748 TAGTCCACAAAATTTCACATAGG - Exonic
917502233 1:175596175-175596197 TTGTGAATAACATTTCACATTGG + Intronic
918746782 1:188211473-188211495 GAGTGCACACAATTTCACATGGG - Intergenic
918850033 1:189676345-189676367 TTATTCACATAATTCCACAAGGG + Intergenic
918956187 1:191210975-191210997 TTGTTCACTAAAATTCACACAGG + Intergenic
920663017 1:207934230-207934252 TTCTGGAAAAAATTTAACAAAGG - Intergenic
923060496 1:230467899-230467921 TAGTATACAAAATTTCCCAATGG - Intergenic
923254521 1:232209990-232210012 TTGGCCATAAAATTACACAATGG - Intergenic
923577813 1:235176532-235176554 TTATTCCCAAAATTTCACAGTGG - Intronic
924694716 1:246386910-246386932 TTGTGCACAGAATATGAAAAAGG + Intronic
924826651 1:247546785-247546807 GTGTGCACCAGAATTCACAAGGG + Intronic
1064214560 10:13388876-13388898 TTGTGTACCACATTTTACAAGGG - Intergenic
1066123097 10:32310615-32310637 TTGTACAAAATATTTCACACAGG + Intronic
1066511051 10:36096545-36096567 TTGTGAATATAATTACACAATGG - Intergenic
1068615341 10:59108516-59108538 TTGTAAACAAAATTTGACCAGGG - Intergenic
1068776004 10:60869017-60869039 TTGTCCAGATATTTTCACAAAGG + Intergenic
1071034344 10:81225033-81225055 TTGTGCACAAAGTCTCATATTGG - Intergenic
1071826312 10:89329564-89329586 TTGTGCTAAAAATTTCCAAATGG + Intronic
1072111121 10:92321155-92321177 ATGTGCACAAAACTACAAAATGG + Intronic
1074599625 10:114900557-114900579 TTGGGAACAAAAATTCCCAAAGG + Intergenic
1077939224 11:6822705-6822727 TTATTCACAAAATTTCAAATAGG - Intergenic
1079253378 11:18804707-18804729 TTGTGAAAAAAATTTCACACTGG - Intergenic
1079592948 11:22203149-22203171 TTTTGGAGAAAATATCACAATGG - Intronic
1080998446 11:37635668-37635690 ATGTGTACAAAATTTCAGATAGG - Intergenic
1084143169 11:67247891-67247913 TTGTGTAAAGAATTTAACAAAGG - Intronic
1085910779 11:80822807-80822829 TTTTTAACAATATTTCACAAGGG - Intergenic
1086275013 11:85116684-85116706 ATGTGCACAAAATGTTACATTGG + Intronic
1087453040 11:98349466-98349488 TTGTCTACAAAATTTAAAAAGGG - Intergenic
1088131232 11:106493911-106493933 TTGTACATAAATGTTCACAACGG + Intergenic
1090143953 11:124298273-124298295 TACTGCAGAAAATTCCACAATGG + Intergenic
1092853952 12:12655613-12655635 TTGTCCAAAAAAGTTCAGAATGG + Intergenic
1093429756 12:19071262-19071284 TTATGCACAAAAGCTCAGAAGGG - Intergenic
1095299506 12:40566480-40566502 TTCTGAACAAAATTTCCCAAGGG + Intronic
1095899721 12:47315367-47315389 TTTTGCACAAAATTGCAGTATGG - Intergenic
1097968297 12:65604603-65604625 TTGTGCAAATGATTTCACAAGGG - Intergenic
1098030867 12:66252340-66252362 TTGTGTTCCAAATTGCACAATGG + Exonic
1099743051 12:86666164-86666186 TTTTGCAGACAATGTCACAAAGG + Intronic
1101276563 12:103208178-103208200 TTGTGCAAATAATTTCCCATTGG - Intergenic
1103424588 12:120821781-120821803 TTGTACACCAATTTTCACAATGG + Intronic
1106320291 13:28631223-28631245 TTCTGCACAATATTTCATAATGG + Intergenic
1107153157 13:37135524-37135546 TTTTTCATAAAATTTCAAAATGG - Intergenic
1107435738 13:40379374-40379396 TTGTGCACACATCTTCACACAGG + Intergenic
1108894783 13:55312273-55312295 ATTTGCACAAACTTTCTCAATGG - Intergenic
1109898936 13:68736988-68737010 ATGTGAACAAAAATTCAAAAGGG + Intergenic
1114937173 14:27554279-27554301 TTGGGCAGAAAAGTTTACAATGG + Intergenic
1116107700 14:40531716-40531738 TTTTGCATGAAATTTGACAAGGG - Intergenic
1116140056 14:40981944-40981966 TTGTGCACATTATTTCAGAGTGG - Intergenic
1117008533 14:51446972-51446994 TTGTACAGGAAATTCCACAATGG + Intergenic
1117709890 14:58516519-58516541 TCCTGCACAAAATTTGCCAAAGG + Intronic
1122039577 14:98974733-98974755 TTGTGCAGAATATTTTACAAGGG - Intergenic
1123634060 15:22285641-22285663 TTATACACAAAATTTCACCGTGG - Intergenic
1123897692 15:24844831-24844853 TTAAGCACAAAATTTAAAAATGG - Intronic
1124554726 15:30713995-30714017 TTTTGCATAAGATTTCAAAAAGG - Intronic
1126735874 15:51731754-51731776 TTCTGCACAAAAATTCACGGTGG + Intronic
1127036002 15:54918234-54918256 TCCTAGACAAAATTTCACAAAGG + Intergenic
1128712294 15:69881264-69881286 ATGTTGACAAAATTTCCCAAAGG - Intergenic
1129009757 15:72404843-72404865 TTGTGGACTAAATACCACAAAGG + Intronic
1129573341 15:76714244-76714266 TTGTGCAGATAGTTTCACAATGG + Intronic
1130293735 15:82627561-82627583 TTGTGGAAAAATTTCCACAAAGG + Intronic
1131493851 15:92885842-92885864 TTGTTCCCAAAATTAAACAAAGG - Intronic
1131813207 15:96194972-96194994 TAATTGACAAAATTTCACAAAGG - Intergenic
1132039157 15:98510602-98510624 TTGTACACAAATTTTCACAGTGG + Intronic
1135864685 16:26090496-26090518 GGGTGCACAAAATTTCCCATGGG + Intronic
1138120020 16:54392865-54392887 TTGTGAAAACAATTTCAAAAAGG - Intergenic
1140866348 16:79065868-79065890 TTATGGTCACAATTTCACAAAGG + Intronic
1141345971 16:83246251-83246273 TTTTGCATAAAATTTCCCACAGG - Intronic
1141540566 16:84717325-84717347 ATCTGCACAAAATTTCTAAAAGG - Intronic
1145112189 17:20173659-20173681 TTATGCCCAACATTTCACCACGG - Intronic
1146840066 17:36145439-36145461 TGGTGAACAATATTTCACATGGG + Intergenic
1147052893 17:37810143-37810165 TTCTGCAGAATATTTCAAAAAGG - Intergenic
1149044208 17:52225498-52225520 TGGTGCACAAACTTGCACAAAGG + Intergenic
1149216907 17:54367358-54367380 TTCTGTACAAAAAATCACAATGG - Intergenic
1150178786 17:63092044-63092066 GTGTGCACAAAAATTAAAAATGG - Intronic
1150535315 17:66032663-66032685 TTGTGCACAAAAAATAATAAAGG - Intronic
1152869651 17:82745686-82745708 TTGTACACAAAGGTTCACAGCGG - Intronic
1153737017 18:8081764-8081786 ATGTCCACCAAATGTCACAAAGG - Intronic
1153796893 18:8631858-8631880 TTCTGCACAAAATTTCACTCTGG + Intronic
1159139881 18:64380817-64380839 TTGTTCACCAAATTTACCAAAGG + Intergenic
1159220295 18:65453817-65453839 TGGTGCAAAAATCTTCACAAAGG + Intergenic
1159306403 18:66648612-66648634 TTGTTAACAAAATTTCACACTGG + Intergenic
1160593507 18:79958468-79958490 TTGTGGACAAAATGTCACAAGGG + Intergenic
1164980401 19:32609364-32609386 CTGTACACAAATGTTCACAATGG + Intronic
1165217768 19:34288816-34288838 TTGTTCACAAAAATTCACTGTGG - Intronic
925327384 2:3034094-3034116 CTGTGCAAGAAGTTTCACAAGGG - Intergenic
925680664 2:6417817-6417839 TTTTTCAAAAAATATCACAATGG + Intergenic
926496168 2:13591570-13591592 TTGTGCACAGTATCTCACAAGGG + Intergenic
926747628 2:16172070-16172092 TTGTTGACCAAATTTTACAATGG + Intergenic
926785144 2:16510948-16510970 TAGTGGACACATTTTCACAAGGG - Intergenic
928375601 2:30770785-30770807 TTGTGCACAAAATGGCAATAGGG + Intronic
928641569 2:33304815-33304837 TTGTGGACAAAATTTTAAAAAGG + Intronic
930846239 2:55907628-55907650 TGCTGCAAAATATTTCACAAGGG + Intronic
931081026 2:58770948-58770970 TAGTTGACAAAATGTCACAAAGG + Intergenic
933437385 2:82264872-82264894 TTGTCCACAAAACTTCACAAAGG + Intergenic
933950751 2:87327151-87327173 CTTTGCACAAAACTTCACTATGG - Intergenic
935031423 2:99326580-99326602 CTGTGCACAAAAAACCACAAAGG + Intronic
935188861 2:100759566-100759588 TTGTGCACAAAAATTCACTTGGG - Intergenic
936329027 2:111531427-111531449 CTTTGCACAAAACTTCACTATGG + Intergenic
937007950 2:118535388-118535410 CTTTGCACAAAATTTTACAAGGG - Intergenic
937231573 2:120400992-120401014 TTGTGTACAAAATGGCACAAGGG - Intergenic
937783209 2:125863931-125863953 TTGTGCACACCACTTCACATGGG - Intergenic
939624344 2:144458544-144458566 ATGTGAACAAAATTACAAAATGG - Intronic
939885702 2:147679247-147679269 TTGTACACAAAATAGCAAAAGGG + Intergenic
940755087 2:157672880-157672902 TTGTGCAGAATATTTAACTAAGG - Intergenic
942883609 2:180894557-180894579 TTTAGCACAAACTTTCACCATGG - Intergenic
942899919 2:181103182-181103204 TTTAACACAAAATTTTACAATGG + Intergenic
944101037 2:196027848-196027870 ATGTCCACAGAGTTTCACAAAGG + Intronic
1170256034 20:14344381-14344403 TTTTACAGAAAATTTCCCAATGG - Intronic
1170900802 20:20461035-20461057 TTTTGCAGAAAATTTGACTAAGG - Intronic
1174052380 20:47775932-47775954 TTGGGTACAAAGTGTCACAACGG + Intronic
1174767832 20:53270581-53270603 CTATGCACAGAATTTCACCAAGG - Intronic
1174984664 20:55437420-55437442 ATCTGCCCAAAATTTCACAGTGG + Intergenic
1177245571 21:18518394-18518416 TTGTGCAGAAATTTGCACAGTGG + Intergenic
1177753750 21:25319453-25319475 TATTACACAAAATTTCTCAAAGG - Intergenic
1178103816 21:29298075-29298097 TTGGGAACATAATTTCAAAACGG + Intronic
1178514156 21:33231483-33231505 TGGTTCACATAATTTGACAATGG + Intronic
1179158240 21:38869832-38869854 TTGTGGTCATCATTTCACAATGG - Intergenic
1179275345 21:39886939-39886961 ATGTTCCAAAAATTTCACAACGG + Intronic
1182648177 22:31827583-31827605 CTCTGCACAAAATTTTCCAAGGG + Intronic
949294754 3:2508275-2508297 CTGGGAACAAAATTTCAAAAGGG - Intronic
949590637 3:5490777-5490799 ATGTGTACAAAATATCACATAGG - Intergenic
949650352 3:6151190-6151212 TTGTTCACATAATTTTACAAGGG - Intergenic
949757552 3:7430645-7430667 TTGTGCAGAAATGTTCACATCGG + Intronic
949793493 3:7819976-7819998 TTGTACACAAAAATGCGCAAAGG - Intergenic
950754126 3:15158258-15158280 TTTTGCACAAAATTCCACTAAGG + Intergenic
951648380 3:24919885-24919907 TTGTGTACAAAAGTCCAAAATGG + Intergenic
952159486 3:30679479-30679501 TTTCGCACAAAATTCCACCAGGG + Intronic
953234531 3:41094633-41094655 TTTTGAAGAAAAGTTCACAAAGG + Intergenic
955128559 3:56139925-56139947 CTGTGGACCAAATTTCACAATGG + Intronic
955559855 3:60177114-60177136 TTTTGTACATAAATTCACAAAGG - Intronic
957674000 3:83343356-83343378 ATATGCACAGAGTTTCACAAAGG + Intergenic
957684752 3:83487513-83487535 TTATGCACATAGTTTCCCAAGGG - Intergenic
957710382 3:83850241-83850263 TTGTGCACAAAATATCTCCAAGG + Intergenic
957995992 3:87690877-87690899 TTATGCACGAAGTTTCTCAATGG + Intergenic
960023581 3:112983658-112983680 TTGTGAAGTAAATTTCTCAATGG - Intergenic
963465644 3:145678031-145678053 TTATGAACAAAAATACACAAAGG + Intergenic
963472000 3:145752278-145752300 GTGTGCACAAACTATCATAAAGG - Intergenic
963518317 3:146335406-146335428 TTGAACACAAAATGTCTCAAAGG + Intergenic
964853841 3:161123866-161123888 TAGGGCACAAAATTTTAAAAAGG + Intronic
965273583 3:166651317-166651339 TTGTGTATAAATTTTCACTATGG + Intergenic
965472891 3:169116987-169117009 TTATGCAAAATATTGCACAAGGG - Intronic
965990171 3:174808308-174808330 TTCTGCACAAAATGTCATATGGG + Intronic
966414247 3:179672898-179672920 TTGTGCACAGAACTGCACATTGG + Intronic
969949314 4:10817658-10817680 TTATGCAGTAAATTTTACAAGGG + Intergenic
971048190 4:22829678-22829700 TTGTGCACAGATTTTAACACAGG - Intergenic
971090897 4:23344383-23344405 GTGTGCACAAAAATTCAGAAAGG + Intergenic
971980973 4:33749901-33749923 TTGTGCAGCAATTTACACAATGG + Intergenic
975876798 4:78849949-78849971 ATGTGGAGAAAATTTAACAAAGG + Intronic
976685743 4:87812755-87812777 ATGTCCAAAATATTTCACAAAGG - Intergenic
976741165 4:88359018-88359040 TTGAGCACATAATTTTAAAAAGG - Intergenic
978600525 4:110422679-110422701 TTCTGAACAAACTGTCACAAGGG + Intronic
979120766 4:116897537-116897559 TTGTGTACAAAACTTCCCAGTGG + Intergenic
979434596 4:120673625-120673647 CTGTGCAGAAGAGTTCACAAGGG - Intergenic
980737907 4:136915259-136915281 TTCTTCAAAAAATTCCACAATGG + Intergenic
981104858 4:140868764-140868786 ATTTGCAAAAAATTTCACAAAGG + Intronic
981177876 4:141703005-141703027 CTATGCAGAAGATTTCACAAAGG + Intronic
981529701 4:145740488-145740510 TTGGGCACTGAATTTCAGAAGGG - Intronic
981738406 4:147977057-147977079 TTGGGCAGAAAATTTCAGAGTGG - Intronic
983776107 4:171609532-171609554 CTGTGCACAAGAGTTCACAAAGG - Intergenic
983823743 4:172230646-172230668 TTGTGAACAGAAATTCAGAAGGG + Intronic
984453344 4:179931963-179931985 TTGTGAACATAAATTCTCAAAGG - Intergenic
984627485 4:182023721-182023743 TTGTGAACAATATACCACAAAGG + Intergenic
985699866 5:1364320-1364342 TTGTGCACAAAATTTCACAAAGG - Intergenic
986417210 5:7541186-7541208 TTCTGTACAAAATATCTCAACGG - Intronic
986926781 5:12764193-12764215 TTATACATAAAAATTCACAATGG - Intergenic
987484037 5:18501313-18501335 TTGTTAACAAAAATTCAGAATGG + Intergenic
990124943 5:52503636-52503658 TAGTGTACAAAATCTCACAGAGG - Intergenic
990660037 5:58002933-58002955 TTGTTCACATAATTTGACATGGG + Intergenic
994478603 5:100303250-100303272 TTTTACACAAAATTTTACGATGG - Intergenic
995173078 5:109140116-109140138 GTGTGCACAGAATTTTAAAAAGG - Intronic
996981528 5:129501576-129501598 TTTTGCAGAAAGTTTCACAAAGG + Intronic
997342865 5:133159464-133159486 TTGTGGCCAAAAGTGCACAATGG - Intergenic
999930998 5:156432714-156432736 TTGTACAGAAGAGTTCACAAGGG + Intronic
1000237533 5:159376454-159376476 CTGTGCAGAAGAGTTCACAAAGG - Intergenic
1000756431 5:165166934-165166956 GTGTGCACAAAATGACAGAAAGG - Intergenic
1004757674 6:18630714-18630736 ATTTGAACAGAATTTCACAAAGG + Intergenic
1008169056 6:48180110-48180132 TTTTTCAGAAAATTTAACAAAGG + Intergenic
1009523431 6:64713637-64713659 TTGTGCACATGTTTTCAGAAGGG + Intronic
1009672363 6:66772634-66772656 TTGTGCACCAAATTCCATAATGG - Intergenic
1010207986 6:73340057-73340079 ATGTTCACAAAATTACAAAATGG - Intergenic
1011272111 6:85590337-85590359 TTTTGGAAAAAATGTCACAAAGG - Intronic
1011282160 6:85687983-85688005 TTGTGCCCAAAATGGCCCAAAGG - Intergenic
1011939260 6:92822533-92822555 TTGTTAACAAAATGTAACAAAGG + Intergenic
1012396936 6:98809517-98809539 TTGGGTACAAAATTTAACAGGGG - Intergenic
1013103464 6:107007021-107007043 TTCTGCACATAACTTTACAAAGG - Intergenic
1013380482 6:109564894-109564916 TTGTGCCAAAACTTTCATAAAGG - Intronic
1013431408 6:110059221-110059243 TAAGGCACAAAATATCACAAAGG - Intergenic
1013531387 6:111022043-111022065 TAGTGAATAAAATTTCCCAACGG - Intronic
1013878059 6:114858139-114858161 GTGTGCAAAATATTTCAGAATGG + Intergenic
1014141094 6:117943517-117943539 CTTTACACAAAATTTCACAATGG - Intronic
1014638217 6:123875862-123875884 TTGTAAAGGAAATTTCACAAAGG - Intronic
1014899419 6:126944696-126944718 TTGGGCACATGATTTCTCAACGG - Intergenic
1017340105 6:153311124-153311146 TTTTACACTAATTTTCACAAAGG + Intergenic
1019001328 6:168755403-168755425 TTATTCTTAAAATTTCACAATGG + Intergenic
1019566346 7:1681292-1681314 TTGTGCACGAATGTTCACAGCGG - Intergenic
1020174528 7:5871692-5871714 TTGTTCAAAGAATTTCACTATGG - Intergenic
1020335095 7:7057004-7057026 TTATGAACAAAATTACAGAAAGG - Intergenic
1020918318 7:14227218-14227240 TTGTTCAAAAAATTTCACTTTGG + Intronic
1022917908 7:34979138-34979160 TTTTCAACAAAGTTTCACAAAGG - Intronic
1023512057 7:40963608-40963630 TTGCACACAAAATTTAATAATGG + Intergenic
1023713991 7:43024354-43024376 GTGTGCAAAAATTTTCACTATGG - Intergenic
1024104303 7:46066391-46066413 GTGAGCACAAAATTTGACCACGG + Intergenic
1026024332 7:66732648-66732670 TTGTGAACCAAATTTCATGATGG - Intronic
1026424785 7:70279855-70279877 TTGTGAAAATAATTTTACAATGG - Intronic
1026889061 7:73971528-73971550 TTGTGAACCAAATTTCATGATGG - Intergenic
1027532024 7:79346832-79346854 TCGTTCACACAATTACACAATGG + Intronic
1028948618 7:96608870-96608892 GTGTACACAAATGTTCACAATGG - Intronic
1029084226 7:97998667-97998689 TTGTTCAAAGAATTTCACTATGG + Intergenic
1031112262 7:117625065-117625087 TTGTGCAGACACTTTCACCATGG - Intronic
1031125267 7:117766372-117766394 TTGTGAAGAAAATTTCAGAATGG - Intronic
1031518423 7:122731206-122731228 TTGTTCACAACTTTTCAGAAAGG - Intronic
1031535369 7:122927445-122927467 TAGAGCACAAAATTTCACTCTGG - Intergenic
1034756098 7:153621184-153621206 GTGTGCTCAATATTTCAGAAGGG + Intergenic
1035309970 7:157961196-157961218 TTTTTCCAAAAATTTCACAATGG + Intronic
1036568815 8:9961699-9961721 TAGTGCAGAATATCTCACAAAGG + Intergenic
1036832945 8:12036317-12036339 TTGGGCACAAAATCACAGAAGGG - Intergenic
1037328655 8:17720838-17720860 TAGTGTAAAACATTTCACAATGG - Intronic
1038231500 8:25704816-25704838 TTGTGAAGAAAGGTTCACAATGG + Intergenic
1038386982 8:27157616-27157638 GTGTGCACAAAAATTTACACTGG + Intergenic
1039211566 8:35221099-35221121 TTAGGTTCAAAATTTCACAATGG - Intergenic
1039655325 8:39398846-39398868 TTGTGCATAAATTTTATCAATGG + Intergenic
1040008605 8:42642205-42642227 TTTTTGAAAAAATTTCACAATGG - Intergenic
1041685419 8:60640353-60640375 TTGGGCACAAAATGAAACAAAGG + Intergenic
1042505402 8:69554440-69554462 TTATGCATAAAACTTCATAAAGG + Intronic
1043760911 8:84066798-84066820 TAGTGGAGAAAATTTCCCAAGGG - Intergenic
1044554794 8:93551347-93551369 TAGAGCACAAAATTTCAGATAGG + Intergenic
1045343063 8:101271391-101271413 TCCTGCACAAACTTTCACCATGG - Intergenic
1045825398 8:106391330-106391352 TCATGCCCAAAATTTCACATTGG - Intronic
1046000382 8:108413870-108413892 ATGTGGAGAAAATTTCACAAAGG + Intronic
1046948945 8:120001779-120001801 TAGAGAACAGAATTTCACAAAGG - Intronic
1049468154 8:142762935-142762957 CTGTGCACAAACATTCACAGTGG - Intergenic
1050585929 9:7111618-7111640 GTGTGCACAAACTTCCTCAAAGG + Intergenic
1051379934 9:16446478-16446500 ATTTGAAAAAAATTTCACAATGG + Intronic
1056906265 9:90650733-90650755 TTTTCAACAAAAATTCACAAAGG + Intergenic
1057399700 9:94712221-94712243 TTTTTCACAAAATCTCTCAAAGG - Intergenic
1059276806 9:113104784-113104806 ATCTGCATAATATTTCACAATGG + Intergenic
1060644984 9:125270516-125270538 TTTTGTAAAAAATTTCAGAAGGG + Intronic
1188622113 X:32238650-32238672 TTGTGAACATAATTTCATATAGG + Intronic
1188728321 X:33612458-33612480 TTGTGAAAACAATTTGACAATGG - Intergenic
1190608205 X:52166900-52166922 TTCTGGAAAAAATGTCACAAAGG + Intergenic
1194538342 X:95136945-95136967 ATGTGCACACACATTCACAATGG - Intergenic
1195769525 X:108335292-108335314 TTATTCACAAAAAGTCACAAAGG + Intronic
1196887339 X:120260755-120260777 TTATGCATAAAGTTTTACAATGG - Exonic
1197256691 X:124270943-124270965 TTGTGTAAGAGATTTCACAATGG - Intronic
1197574323 X:128190963-128190985 TTATTCTCAAAATTTCATAATGG - Intergenic
1198230986 X:134689254-134689276 CTGTGCTCAAAATTCTACAAGGG + Intronic
1198732554 X:139748023-139748045 TTGAGTACAAAATATCATAAGGG - Intronic
1200085045 X:153599723-153599745 CTGTGCACAAAATTCCAAGAGGG + Intronic
1201546831 Y:15174570-15174592 TTATGTACAAAATTTCATATAGG - Intergenic
1202305438 Y:23465309-23465331 TTATACACAAAATTTCACCACGG - Intergenic
1202565371 Y:26205280-26205302 TTATACACAAAATTTCACCACGG + Intergenic