ID: 985700465

View in Genome Browser
Species Human (GRCh38)
Location 5:1368840-1368862
Sequence GGACAGGTCAATGCAAATTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985700465_985700470 4 Left 985700465 5:1368840-1368862 CCTTAATTTGCATTGACCTGTCC No data
Right 985700470 5:1368867-1368889 AGTTGCACGTAATTGAAAGCGGG No data
985700465_985700469 3 Left 985700465 5:1368840-1368862 CCTTAATTTGCATTGACCTGTCC No data
Right 985700469 5:1368866-1368888 AAGTTGCACGTAATTGAAAGCGG No data
985700465_985700471 13 Left 985700465 5:1368840-1368862 CCTTAATTTGCATTGACCTGTCC No data
Right 985700471 5:1368876-1368898 TAATTGAAAGCGGGTAGAAGTGG No data
985700465_985700472 14 Left 985700465 5:1368840-1368862 CCTTAATTTGCATTGACCTGTCC No data
Right 985700472 5:1368877-1368899 AATTGAAAGCGGGTAGAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985700465 Original CRISPR GGACAGGTCAATGCAAATTA AGG (reversed) Intergenic
No off target data available for this crispr