ID: 985700469

View in Genome Browser
Species Human (GRCh38)
Location 5:1368866-1368888
Sequence AAGTTGCACGTAATTGAAAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985700464_985700469 4 Left 985700464 5:1368839-1368861 CCCTTAATTTGCATTGACCTGTC No data
Right 985700469 5:1368866-1368888 AAGTTGCACGTAATTGAAAGCGG No data
985700461_985700469 28 Left 985700461 5:1368815-1368837 CCTAGAAAGTTCTATATAACCTG No data
Right 985700469 5:1368866-1368888 AAGTTGCACGTAATTGAAAGCGG No data
985700462_985700469 9 Left 985700462 5:1368834-1368856 CCTGCCCCTTAATTTGCATTGAC No data
Right 985700469 5:1368866-1368888 AAGTTGCACGTAATTGAAAGCGG No data
985700465_985700469 3 Left 985700465 5:1368840-1368862 CCTTAATTTGCATTGACCTGTCC No data
Right 985700469 5:1368866-1368888 AAGTTGCACGTAATTGAAAGCGG No data
985700463_985700469 5 Left 985700463 5:1368838-1368860 CCCCTTAATTTGCATTGACCTGT No data
Right 985700469 5:1368866-1368888 AAGTTGCACGTAATTGAAAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985700469 Original CRISPR AAGTTGCACGTAATTGAAAG CGG Intergenic
No off target data available for this crispr