ID: 985700471

View in Genome Browser
Species Human (GRCh38)
Location 5:1368876-1368898
Sequence TAATTGAAAGCGGGTAGAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985700466_985700471 -3 Left 985700466 5:1368856-1368878 CCTGTCCCTTAAGTTGCACGTAA No data
Right 985700471 5:1368876-1368898 TAATTGAAAGCGGGTAGAAGTGG No data
985700462_985700471 19 Left 985700462 5:1368834-1368856 CCTGCCCCTTAATTTGCATTGAC No data
Right 985700471 5:1368876-1368898 TAATTGAAAGCGGGTAGAAGTGG No data
985700467_985700471 -8 Left 985700467 5:1368861-1368883 CCCTTAAGTTGCACGTAATTGAA No data
Right 985700471 5:1368876-1368898 TAATTGAAAGCGGGTAGAAGTGG No data
985700465_985700471 13 Left 985700465 5:1368840-1368862 CCTTAATTTGCATTGACCTGTCC No data
Right 985700471 5:1368876-1368898 TAATTGAAAGCGGGTAGAAGTGG No data
985700463_985700471 15 Left 985700463 5:1368838-1368860 CCCCTTAATTTGCATTGACCTGT No data
Right 985700471 5:1368876-1368898 TAATTGAAAGCGGGTAGAAGTGG No data
985700464_985700471 14 Left 985700464 5:1368839-1368861 CCCTTAATTTGCATTGACCTGTC No data
Right 985700471 5:1368876-1368898 TAATTGAAAGCGGGTAGAAGTGG No data
985700468_985700471 -9 Left 985700468 5:1368862-1368884 CCTTAAGTTGCACGTAATTGAAA No data
Right 985700471 5:1368876-1368898 TAATTGAAAGCGGGTAGAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985700471 Original CRISPR TAATTGAAAGCGGGTAGAAG TGG Intergenic
No off target data available for this crispr