ID: 985702771

View in Genome Browser
Species Human (GRCh38)
Location 5:1383534-1383556
Sequence GGGATCCTGCCAATATCCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985702771_985702774 -6 Left 985702771 5:1383534-1383556 CCTTGGGATATTGGCAGGATCCC No data
Right 985702774 5:1383551-1383573 GATCCCGGGCCCTGCTGCTGTGG No data
985702771_985702781 19 Left 985702771 5:1383534-1383556 CCTTGGGATATTGGCAGGATCCC No data
Right 985702781 5:1383576-1383598 TCGGGACTTCACTTCCTTGCTGG No data
985702771_985702782 26 Left 985702771 5:1383534-1383556 CCTTGGGATATTGGCAGGATCCC No data
Right 985702782 5:1383583-1383605 TTCACTTCCTTGCTGGTCAGAGG No data
985702771_985702778 1 Left 985702771 5:1383534-1383556 CCTTGGGATATTGGCAGGATCCC No data
Right 985702778 5:1383558-1383580 GGCCCTGCTGCTGTGGACTCGGG No data
985702771_985702777 0 Left 985702771 5:1383534-1383556 CCTTGGGATATTGGCAGGATCCC No data
Right 985702777 5:1383557-1383579 GGGCCCTGCTGCTGTGGACTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985702771 Original CRISPR GGGATCCTGCCAATATCCCA AGG (reversed) Intergenic
No off target data available for this crispr