ID: 985703298

View in Genome Browser
Species Human (GRCh38)
Location 5:1386476-1386498
Sequence ACGCGCGCCCGGCGTCAACG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985703298_985703308 17 Left 985703298 5:1386476-1386498 CCCCGTTGACGCCGGGCGCGCGT No data
Right 985703308 5:1386516-1386538 TCTTCAAAGCCGGCAGCGTCTGG No data
985703298_985703311 27 Left 985703298 5:1386476-1386498 CCCCGTTGACGCCGGGCGCGCGT No data
Right 985703311 5:1386526-1386548 CGGCAGCGTCTGGTCTGGCCTGG No data
985703298_985703305 7 Left 985703298 5:1386476-1386498 CCCCGTTGACGCCGGGCGCGCGT No data
Right 985703305 5:1386506-1386528 GCCGAGCCGCTCTTCAAAGCCGG No data
985703298_985703309 22 Left 985703298 5:1386476-1386498 CCCCGTTGACGCCGGGCGCGCGT No data
Right 985703309 5:1386521-1386543 AAAGCCGGCAGCGTCTGGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985703298 Original CRISPR ACGCGCGCCCGGCGTCAACG GGG (reversed) Intergenic
No off target data available for this crispr