ID: 985703299

View in Genome Browser
Species Human (GRCh38)
Location 5:1386477-1386499
Sequence CACGCGCGCCCGGCGTCAAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985703299_985703305 6 Left 985703299 5:1386477-1386499 CCCGTTGACGCCGGGCGCGCGTG No data
Right 985703305 5:1386506-1386528 GCCGAGCCGCTCTTCAAAGCCGG No data
985703299_985703308 16 Left 985703299 5:1386477-1386499 CCCGTTGACGCCGGGCGCGCGTG No data
Right 985703308 5:1386516-1386538 TCTTCAAAGCCGGCAGCGTCTGG No data
985703299_985703309 21 Left 985703299 5:1386477-1386499 CCCGTTGACGCCGGGCGCGCGTG No data
Right 985703309 5:1386521-1386543 AAAGCCGGCAGCGTCTGGTCTGG No data
985703299_985703311 26 Left 985703299 5:1386477-1386499 CCCGTTGACGCCGGGCGCGCGTG No data
Right 985703311 5:1386526-1386548 CGGCAGCGTCTGGTCTGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985703299 Original CRISPR CACGCGCGCCCGGCGTCAAC GGG (reversed) Intergenic
No off target data available for this crispr