ID: 985703300

View in Genome Browser
Species Human (GRCh38)
Location 5:1386478-1386500
Sequence CCACGCGCGCCCGGCGTCAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985703300_985703309 20 Left 985703300 5:1386478-1386500 CCGTTGACGCCGGGCGCGCGTGG No data
Right 985703309 5:1386521-1386543 AAAGCCGGCAGCGTCTGGTCTGG No data
985703300_985703308 15 Left 985703300 5:1386478-1386500 CCGTTGACGCCGGGCGCGCGTGG No data
Right 985703308 5:1386516-1386538 TCTTCAAAGCCGGCAGCGTCTGG No data
985703300_985703305 5 Left 985703300 5:1386478-1386500 CCGTTGACGCCGGGCGCGCGTGG No data
Right 985703305 5:1386506-1386528 GCCGAGCCGCTCTTCAAAGCCGG No data
985703300_985703311 25 Left 985703300 5:1386478-1386500 CCGTTGACGCCGGGCGCGCGTGG No data
Right 985703311 5:1386526-1386548 CGGCAGCGTCTGGTCTGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985703300 Original CRISPR CCACGCGCGCCCGGCGTCAA CGG (reversed) Intergenic