ID: 985703304

View in Genome Browser
Species Human (GRCh38)
Location 5:1386501-1386523
Sequence TTTGAAGAGCGGCTCGGCCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985703304_985703311 2 Left 985703304 5:1386501-1386523 CCGCGGCCGAGCCGCTCTTCAAA No data
Right 985703311 5:1386526-1386548 CGGCAGCGTCTGGTCTGGCCTGG No data
985703304_985703313 22 Left 985703304 5:1386501-1386523 CCGCGGCCGAGCCGCTCTTCAAA No data
Right 985703313 5:1386546-1386568 TGGCTCCGCCAGCTGCCCGCAGG No data
985703304_985703309 -3 Left 985703304 5:1386501-1386523 CCGCGGCCGAGCCGCTCTTCAAA No data
Right 985703309 5:1386521-1386543 AAAGCCGGCAGCGTCTGGTCTGG No data
985703304_985703308 -8 Left 985703304 5:1386501-1386523 CCGCGGCCGAGCCGCTCTTCAAA No data
Right 985703308 5:1386516-1386538 TCTTCAAAGCCGGCAGCGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985703304 Original CRISPR TTTGAAGAGCGGCTCGGCCG CGG (reversed) Intergenic
No off target data available for this crispr