ID: 985703309

View in Genome Browser
Species Human (GRCh38)
Location 5:1386521-1386543
Sequence AAAGCCGGCAGCGTCTGGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985703303_985703309 11 Left 985703303 5:1386487-1386509 CCGGGCGCGCGTGGCCGCGGCCG No data
Right 985703309 5:1386521-1386543 AAAGCCGGCAGCGTCTGGTCTGG No data
985703298_985703309 22 Left 985703298 5:1386476-1386498 CCCCGTTGACGCCGGGCGCGCGT No data
Right 985703309 5:1386521-1386543 AAAGCCGGCAGCGTCTGGTCTGG No data
985703306_985703309 -9 Left 985703306 5:1386507-1386529 CCGAGCCGCTCTTCAAAGCCGGC No data
Right 985703309 5:1386521-1386543 AAAGCCGGCAGCGTCTGGTCTGG No data
985703300_985703309 20 Left 985703300 5:1386478-1386500 CCGTTGACGCCGGGCGCGCGTGG No data
Right 985703309 5:1386521-1386543 AAAGCCGGCAGCGTCTGGTCTGG No data
985703299_985703309 21 Left 985703299 5:1386477-1386499 CCCGTTGACGCCGGGCGCGCGTG No data
Right 985703309 5:1386521-1386543 AAAGCCGGCAGCGTCTGGTCTGG No data
985703304_985703309 -3 Left 985703304 5:1386501-1386523 CCGCGGCCGAGCCGCTCTTCAAA No data
Right 985703309 5:1386521-1386543 AAAGCCGGCAGCGTCTGGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985703309 Original CRISPR AAAGCCGGCAGCGTCTGGTC TGG Intergenic
No off target data available for this crispr