ID: 985704988

View in Genome Browser
Species Human (GRCh38)
Location 5:1395234-1395256
Sequence CGCTGCACTTGCGCCCGCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 51
Summary {0: 1, 1: 0, 2: 2, 3: 4, 4: 44}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985704988_985704991 -5 Left 985704988 5:1395234-1395256 CCCGCGCGGGCGCAAGTGCAGCG 0: 1
1: 0
2: 2
3: 4
4: 44
Right 985704991 5:1395252-1395274 CAGCGTGTACTGACTGCTCAGGG 0: 1
1: 0
2: 0
3: 11
4: 68
985704988_985704990 -6 Left 985704988 5:1395234-1395256 CCCGCGCGGGCGCAAGTGCAGCG 0: 1
1: 0
2: 2
3: 4
4: 44
Right 985704990 5:1395251-1395273 GCAGCGTGTACTGACTGCTCAGG 0: 1
1: 0
2: 0
3: 9
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985704988 Original CRISPR CGCTGCACTTGCGCCCGCGC GGG (reversed) Intronic