ID: 985708459

View in Genome Browser
Species Human (GRCh38)
Location 5:1414895-1414917
Sequence CTGTGTCTGGGGAAGGGGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1074
Summary {0: 1, 1: 0, 2: 23, 3: 115, 4: 935}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985708450_985708459 -2 Left 985708450 5:1414874-1414896 CCAGTCATTATTCTTAATTTACT 0: 1
1: 0
2: 2
3: 34
4: 387
Right 985708459 5:1414895-1414917 CTGTGTCTGGGGAAGGGGGCGGG 0: 1
1: 0
2: 23
3: 115
4: 935
985708449_985708459 26 Left 985708449 5:1414846-1414868 CCAGCTGAGCTGCAGCAGCTGCA 0: 1
1: 0
2: 3
3: 67
4: 478
Right 985708459 5:1414895-1414917 CTGTGTCTGGGGAAGGGGGCGGG 0: 1
1: 0
2: 23
3: 115
4: 935

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985708459 Original CRISPR CTGTGTCTGGGGAAGGGGGC GGG Intronic
900035297 1:402694-402716 CTGAGTCTGGGGAAGGGAGCTGG + Intergenic
900056918 1:638447-638469 CTGAGTCTGGGGAAGGGAGCTGG + Intergenic
900391407 1:2435538-2435560 CAGGGACTGGGGAAGGGGCCAGG + Intronic
900659527 1:3775693-3775715 CTGGGTCAGGGGGAGGGGCCTGG - Intronic
900958263 1:5901942-5901964 TTGTCTTTGGGGGAGGGGGCTGG - Intronic
900991927 1:6102033-6102055 CTGTGCCTGGGGAAAGGGGTCGG + Exonic
901053500 1:6437714-6437736 CTGTGTCTAGGGAGTGGGGAGGG + Intronic
901161201 1:7177687-7177709 CTGTGTGTGGGGAGGGGTACTGG - Intronic
901193311 1:7425430-7425452 CTGTGAATGGCGATGGGGGCAGG + Intronic
901757697 1:11451272-11451294 CTGGGGCTGGGGAAGCGGGAGGG + Intergenic
901860765 1:12072949-12072971 CTATGTGTGGGGAAGGGGCAGGG - Intronic
901971861 1:12914536-12914558 CTGTGAGTGGAGAAGGGGTCAGG + Intronic
902013307 1:13287204-13287226 CTGTGAGTGGAGAAGGGGTCAGG - Intergenic
902092678 1:13915996-13916018 CTGTGGCAGGGGTTGGGGGCCGG + Intergenic
902361176 1:15943374-15943396 GTGGGTGTGGGGGAGGGGGCAGG + Intronic
902411252 1:16212729-16212751 CCGGTTCTGGGGAAGGGGGGCGG - Intergenic
902480782 1:16710451-16710473 CTGTGTCTAGGGAGTGGGGAGGG - Intergenic
902822217 1:18950339-18950361 CTTTGCCAGGGGAAGGGGGCTGG + Intronic
902973512 1:20072148-20072170 GTGTGTTTGGGGATGGGGACGGG - Intronic
903010188 1:20324365-20324387 CTGGGGGTGGGGCAGGGGGCAGG - Intronic
903060408 1:20664861-20664883 CTCTGGCTGGGCAGGGGGGCGGG - Intronic
903157851 1:21460371-21460393 CTGTCCCTGGGGTTGGGGGCTGG - Intronic
903176822 1:21586412-21586434 CCGTCTCTGGGGAAGGCGGGTGG + Intergenic
903280851 1:22249033-22249055 CTGGGTGTGGGGCAGGGGGGAGG + Intergenic
903557859 1:24206398-24206420 CTGGGGCTGGGGAAGGGAGAGGG - Intergenic
903674013 1:25053191-25053213 GTGTGTGTGGGGATGGGGGTGGG - Intergenic
903794954 1:25921773-25921795 CTGTCTCTGGAGAGAGGGGCGGG - Intergenic
904043668 1:27598292-27598314 GTGTGTGTGGTGGAGGGGGCTGG + Intronic
904435431 1:30491914-30491936 CTGGGTCTGGGGAAGGAAGCTGG - Intergenic
904466999 1:30714204-30714226 CTGGGGCTGGGGAGGGGCGCAGG - Intronic
904559399 1:31386577-31386599 CTGTGTCTGGGGTTGGGGTGAGG + Intergenic
904810133 1:33158176-33158198 CTGTGTTTAGGACAGGGGGCTGG + Intronic
905035880 1:34918215-34918237 CTGTGTCAGTGGATGGTGGCAGG - Intronic
905110151 1:35588832-35588854 CTGGGTCTGGGGAAGAGAGAGGG + Intronic
905337032 1:37251878-37251900 ATGTCTCAGGGGAAGGGGCCTGG + Intergenic
905626393 1:39492557-39492579 GTGTGTCTGGGGCAGGGTGAAGG - Intronic
905775119 1:40663399-40663421 TTGTGGCTGGGGAGTGGGGCAGG + Intronic
905775993 1:40667444-40667466 CTGTCTCTGTGAAAGGGGCCAGG - Intergenic
906057086 1:42925697-42925719 GTGTGTGTGGGGAGGGGTGCAGG + Exonic
906078315 1:43068133-43068155 CTGCGACTGGGGAAGGGAGCAGG + Intergenic
906183237 1:43839562-43839584 CTGTCTCTGGGGAAGGAGTCTGG - Intronic
906293604 1:44635698-44635720 TAGTGTCGGGGGAAGGGAGCGGG - Intronic
906688807 1:47779340-47779362 GTGTGTGTGGGGAGAGGGGCTGG + Intronic
907012735 1:50978232-50978254 CTGTGCCTGAGGACCGGGGCCGG + Intergenic
907045973 1:51300285-51300307 GTGGGGCTGGGGAAGGGAGCAGG - Intronic
907372620 1:54013045-54013067 GTGTGTGTGGGGGAGGCGGCGGG + Intronic
907454190 1:54564750-54564772 CTGAGGCTGGGGAAGAGAGCCGG - Intronic
907459776 1:54598526-54598548 CTGCGTCTGGGGATGGGACCAGG + Intronic
907883203 1:58570369-58570391 CTGTGACTGAGGAAGTGGGCTGG - Intergenic
908060397 1:60342111-60342133 CAGTCTCTGGGAAAGGGAGCAGG + Intergenic
908518932 1:64922043-64922065 CTGTGTCTCAGGAAGGGTGATGG - Intronic
908699823 1:66886938-66886960 CTTAGTCTGGGGATGGGGGGTGG - Intronic
909475236 1:76074664-76074686 CAGTGGATGGGGACGGGGGCGGG + Intergenic
909965521 1:81904860-81904882 CTCTGTCTCGGGGTGGGGGCAGG + Intronic
910430786 1:87157651-87157673 TTGTGTCTGGGGGAGCAGGCAGG + Intronic
910535754 1:88295697-88295719 CTGCGTCAGGGGAAAGGAGCAGG - Intergenic
910840127 1:91553467-91553489 CTTTGGCTGGGGAACTGGGCTGG - Intergenic
910896120 1:92071249-92071271 GTGTGTATGGGGTAGGGGGCAGG - Intergenic
911293451 1:96084764-96084786 ATTTGTCTGGGGATGGGGACAGG - Intergenic
912442894 1:109712482-109712504 GTGTGTTTGGGGGTGGGGGCGGG + Intronic
912465033 1:109866535-109866557 GTGTGTATGGGGATGGGGGTGGG + Intergenic
912467037 1:109881451-109881473 CTGTGACTCGGGCAGGTGGCAGG - Intergenic
912507064 1:110163674-110163696 CTGTGTGTGAGGACTGGGGCAGG - Intronic
912659556 1:111515747-111515769 CTGCGGCTGGTGGAGGGGGCGGG + Intronic
912672589 1:111644774-111644796 CTTTTTTTGGGGAAGGGGGAGGG + Intronic
913450761 1:118991030-118991052 GTGTGTCTGTGGAATGGGGGTGG - Intergenic
913937236 1:125065929-125065951 CTGTGTCTGGGGCTGGGGCTGGG - Intergenic
913973147 1:143431922-143431944 CTGTCTCTGGGGAGAGGAGCAGG - Intergenic
913998855 1:143675347-143675369 GCGTGTCTGGGGCAGGAGGCCGG + Intergenic
914067531 1:144257529-144257551 CTGTCTCTGGGGAGAGGAGCAGG - Intergenic
914111622 1:144708825-144708847 CTGTCTCTGGGGAGAGGAGCAGG + Intergenic
914736911 1:150426699-150426721 CAGGGACTGGGGTAGGGGGCAGG + Intronic
914804876 1:150984418-150984440 GGGTGTCTGGGGAAGGGAGAAGG + Intronic
914847730 1:151292193-151292215 CTGGGTTTGGGGAAGGAGTCAGG + Exonic
915046176 1:153018749-153018771 CCCTGTCTGGTGAAGGGGGATGG - Intergenic
915243707 1:154541725-154541747 CCCTGTCTGGGGAAGGCTGCTGG + Intronic
915285235 1:154848093-154848115 CTCTGGCTGGGGAGGGGGGGAGG - Intronic
915459154 1:156059482-156059504 ATGGCACTGGGGAAGGGGGCTGG - Intergenic
915977937 1:160402660-160402682 CTGTGTGTCGGGAAAGGGCCAGG + Intronic
916425442 1:164675716-164675738 CAGTGTCTGGGGGCGGGGTCTGG - Intronic
916549868 1:165839930-165839952 CTCTGTCTGGGGCGGGGGCCGGG - Intronic
917684115 1:177398549-177398571 GTGTGTCTGTGGGAGGGGACAGG - Intergenic
918004033 1:180525091-180525113 CTTTGCCTGGGGCTGGGGGCAGG - Intergenic
918082960 1:181221576-181221598 CAGTGTCTGGGGGAGGCGGAGGG + Intergenic
918133180 1:181646645-181646667 CTGTCTCTGGGGCTGGGGGCTGG + Intronic
918412793 1:184277673-184277695 CTCTGTGTGTGGAAGGGGACAGG + Intergenic
919012733 1:191986287-191986309 TTGTGGCTGGGGAAGGGGTGGGG - Intergenic
919834925 1:201567055-201567077 CGGTGGCTGGGGATGGGGGGTGG - Intergenic
920047105 1:203140426-203140448 CTGTTTCTGGGGATGGGGAAGGG + Intronic
920294092 1:204945361-204945383 AGATGTCTGGGGAGGGGGGCAGG + Intronic
920371299 1:205481069-205481091 ATGGGGCTGGGGGAGGGGGCAGG - Intergenic
920694816 1:208174276-208174298 TTGTGTGTGGGGTTGGGGGCTGG + Intronic
921165303 1:212502656-212502678 GTATGGCTGGGAAAGGGGGCTGG - Intergenic
921752885 1:218817994-218818016 CTCTGTAAGGGGAGGGGGGCGGG - Intergenic
922187091 1:223285300-223285322 CAGTGACTGGGGATGGGGCCAGG + Intronic
922257827 1:223908254-223908276 CTGAGTCTGGGGAAGGGAGCTGG + Intergenic
922855357 1:228770400-228770422 CTGTGTCAGTGGAAGGGTGCAGG + Intergenic
923202262 1:231724168-231724190 CTCTGTGTGGGGAAGGGGGCAGG + Intronic
923639553 1:235740425-235740447 TTGTCTCTGTGGAAGGGGGACGG - Intronic
923656180 1:235919137-235919159 CGGGGTCTGGGTAAGGGGTCTGG - Intergenic
923659494 1:235945950-235945972 CTTTGGCAGGGGAAGGGTGCTGG + Intergenic
924339025 1:243011033-243011055 CTGAGTCTGGGGAAGGGAGCTGG + Intergenic
1063376331 10:5556775-5556797 CTTTGTCTCAGGAAGGTGGCAGG - Intergenic
1063624290 10:7675023-7675045 TTGTGTGTGGGGGGGGGGGCGGG - Intergenic
1063667654 10:8073868-8073890 ATGTGTCTGGAGAGGGCGGCCGG - Exonic
1063753166 10:8975594-8975616 GTCTGTCTGTGGGAGGGGGCAGG - Intergenic
1065000608 10:21334631-21334653 GTGTCTCTGGGGCTGGGGGCTGG - Intergenic
1065431396 10:25660998-25661020 CTCTGTCTGGGGAAAGGGGAGGG - Intergenic
1065716062 10:28569658-28569680 CTGTGGCTGGGCAAGGAGGTTGG + Intronic
1066258867 10:33709265-33709287 CTGGGTCTGGGACAGGGTGCGGG + Intergenic
1066491959 10:35902484-35902506 CTGTGTCTGGGGAAGTTTGATGG + Intergenic
1066708291 10:38204256-38204278 CTCTGCCTGGGGAAAGGGGAGGG + Intergenic
1066981218 10:42418326-42418348 CTCTGCCTGGGGAAAGGGGAGGG - Intergenic
1067228333 10:44389717-44389739 GTGTGTGTGGGGGGGGGGGCGGG + Intergenic
1067448001 10:46364729-46364751 CTGTATCTGGGAAAGGAGGCTGG - Intergenic
1067589377 10:47496032-47496054 CTGTATCTGGGAAAGGAGGCTGG + Intergenic
1067636503 10:48004111-48004133 CTGTATCTGGGAAAGGAGGCTGG + Intergenic
1067726329 10:48773990-48774012 CTCTGTGGGGGGAAGGTGGCTGG - Intronic
1068502846 10:57861988-57862010 CAGTGTCTGGAGAAGGGAGACGG - Intergenic
1069183796 10:65396827-65396849 CTGTGTCTGGGATAGGAGGGTGG - Intergenic
1069595764 10:69669048-69669070 CTGAGGCTGGGGATGGGGGTGGG + Intergenic
1069625558 10:69865736-69865758 TTGAGTCTAGAGAAGGGGGCTGG + Intronic
1069776152 10:70928467-70928489 CTGTGTTTGGGGAGGGGAGCAGG + Intergenic
1070276584 10:75013060-75013082 ATGTCTTTGGGGAAGGAGGCTGG - Intronic
1070312606 10:75284423-75284445 CTGGGTTGGGGGAAGGGGACTGG + Intergenic
1070321193 10:75355916-75355938 ATGTGTCTGGTGGATGGGGCTGG + Intergenic
1070741583 10:78907048-78907070 CTGTGTGGAGGGAAGGGGACAGG - Intergenic
1070769109 10:79071957-79071979 CAGTGACTGGGGGTGGGGGCTGG + Intronic
1070770050 10:79077032-79077054 CTGTGTATGGGGAAGCAGGGAGG + Intronic
1071411242 10:85399143-85399165 CTGTGTCTGGGGGAGGTAGTTGG - Intergenic
1071608619 10:87015939-87015961 CTGTATCCGGGAAAGGAGGCTGG - Intergenic
1072058841 10:91788434-91788456 CTGTGCCTGGGGAAAGGAGAGGG + Intergenic
1073059543 10:100725074-100725096 GTGTGTATGGGGGAGGGGGAGGG - Intergenic
1073426764 10:103459727-103459749 ATGTGTCTGTGGAGGAGGGCTGG - Intergenic
1073529288 10:104216640-104216662 CTGTGGGTGGGGAAGGGGAGAGG - Intronic
1074080864 10:110167097-110167119 CTCAGGCTGGAGAAGGGGGCTGG - Intergenic
1074547533 10:114412899-114412921 CTGTGTCTGGGCTCTGGGGCTGG - Intergenic
1074767973 10:116714544-116714566 GTGTGTCTGGGGGAGGGGGCAGG - Intronic
1074781364 10:116804540-116804562 CTGTGGCTGGGGCTGGGGGCTGG - Intergenic
1075060533 10:119253781-119253803 CTTTGCCTGGGGTGGGGGGCTGG + Intronic
1075379990 10:122011234-122011256 GTGTGGCTGGGGAAGTGGGAAGG + Intronic
1075558139 10:123448065-123448087 ATGAGTCTGGGGAGGGGGCCTGG + Intergenic
1075677746 10:124307998-124308020 CTGTGTCTGGGGAAGGTGTCAGG + Intergenic
1076411552 10:130255092-130255114 CTGTGGCTGTTGAAGGGGCCTGG + Intergenic
1076601471 10:131659377-131659399 CTGTGTCTGGAGAAGGGGCCAGG + Intergenic
1076822350 10:132945732-132945754 TGGAGTCTGGGAAAGGGGGCTGG + Intergenic
1076897011 10:133317876-133317898 CTGTGTCTGGGGGGGGGGTGTGG - Intronic
1076897119 10:133318272-133318294 CTGTGTCTGGGGGGGGGGTGTGG - Intronic
1076980138 11:199757-199779 CAGTGTCTAGGGAAAAGGGCAGG - Intronic
1077051721 11:569564-569586 CCGGGGCTGGGGCAGGGGGCAGG - Intergenic
1077394617 11:2314963-2314985 CTGTCTAGGGGGAAGGGTGCAGG + Intronic
1077971136 11:7192426-7192448 CAGGGTGTGGGGATGGGGGCAGG - Intergenic
1078142629 11:8703072-8703094 CTTTGTCTGGGGAGGTGGGCAGG - Intronic
1078161746 11:8846204-8846226 CTATGTCTGGGGAAAGGGAGAGG + Intronic
1078334872 11:10455507-10455529 CTGTGTGTGTGGATGGGGGTGGG + Intronic
1078913794 11:15758672-15758694 CTCTGACTTGGGGAGGGGGCGGG - Intergenic
1078929287 11:15901126-15901148 AGGGGCCTGGGGAAGGGGGCAGG - Intergenic
1078935946 11:15950311-15950333 CTGAATCTGAGGAAGGGGCCTGG - Intergenic
1079026230 11:16950072-16950094 GTGTGTGTGGGGCGGGGGGCGGG + Intronic
1079027593 11:16961198-16961220 CTGGGACTGGGGATGGGGACAGG - Intronic
1079245492 11:18749465-18749487 CTATGTCTGGGGTCGGGGGAGGG + Intronic
1080574092 11:33582685-33582707 GTGTCTCAGGGCAAGGGGGCTGG - Intronic
1080633672 11:34104940-34104962 GTGTATCTGGGGAAGGGGTTTGG + Intergenic
1080789616 11:35510463-35510485 CTGTTTCCGGGGGTGGGGGCGGG - Intronic
1081650294 11:44819100-44819122 CTGGATCTGGGGAAGGAGTCAGG + Intronic
1081917044 11:46738976-46738998 CTGTGTCTCGTGAAGGGGCGTGG + Intronic
1082071601 11:47943949-47943971 GTGTGTGTGGGGGGGGGGGCGGG + Intergenic
1082628477 11:55513544-55513566 CTGCTTCTGGGGGAGGGGGGTGG - Intergenic
1083325811 11:61872474-61872496 ATGTGTGTGGAGTAGGGGGCGGG + Intergenic
1083339883 11:61952107-61952129 CTGAGGCTGGGGCTGGGGGCTGG + Intronic
1083389233 11:62335959-62335981 CTGAGGCTGGGGAAGGTGGCTGG - Intergenic
1083655867 11:64229369-64229391 CTGGGTCTTGGGAAGGTGGGTGG + Intronic
1083802985 11:65057537-65057559 GTGTGGGTGGGGAAGGGGGGTGG + Intronic
1083842978 11:65315211-65315233 CTGGGTCTCGGGAGGGGGGCGGG - Intronic
1083889427 11:65588609-65588631 CTGTGTCGGGGTCATGGGGCAGG - Intronic
1083935623 11:65868422-65868444 CTGTGCCAGGGGAGAGGGGCTGG + Intronic
1083997262 11:66278549-66278571 CTGGGGCTGGGGCTGGGGGCGGG + Intronic
1084057232 11:66643379-66643401 CAGTGTCTGGGGTAGGGGCTGGG + Intronic
1084211931 11:67628395-67628417 CTTTTGCTGGGGAAGAGGGCAGG + Exonic
1084546976 11:69819441-69819463 ATTGGTCTGGGGGAGGGGGCGGG - Intergenic
1084680496 11:70663676-70663698 CTGTCTCTGGGGAGGGGGCAAGG - Intronic
1084856328 11:71990002-71990024 CTTTGCCTGGGGAAGGGGCCAGG + Intronic
1084935703 11:72585505-72585527 CTGTGTGTGGGCATGGGGGCTGG - Intronic
1085029041 11:73258555-73258577 CTGGGCCTCAGGAAGGGGGCTGG + Intergenic
1085048288 11:73365925-73365947 CTGTGTCTGGGGGAGGTGGTGGG - Exonic
1085479003 11:76806347-76806369 TTATGGCTGGGGAAGGGAGCAGG - Intergenic
1086064451 11:82731903-82731925 CTGTGGCTGAGGGAGGAGGCCGG - Exonic
1086120292 11:83298808-83298830 TTGTGTCTGCAGAAGAGGGCTGG - Intergenic
1086960191 11:92973337-92973359 CAGTGGCTGGGGGAGGGAGCAGG - Intronic
1087313323 11:96576881-96576903 CTCTGCCTGGGGAAAGGGGAGGG - Intergenic
1088685600 11:112282032-112282054 CTGTGGCAGGGGATGAGGGCAGG + Intergenic
1088973193 11:114791433-114791455 CTGTGACTAGGTAAGGGGCCAGG - Intergenic
1089112383 11:116067063-116067085 TTGTTCCTGGGGAATGGGGCAGG + Intergenic
1089136822 11:116255824-116255846 CGGGGTCGGGGGAGGGGGGCAGG + Intergenic
1089173500 11:116532462-116532484 CTATATCTGGGGATGGGGGAAGG + Intergenic
1089207933 11:116779895-116779917 CTATGTCGGGGGAGGGGGGAGGG + Intronic
1089303483 11:117512602-117512624 CTGAGGGTGGGGAAGGGGGAAGG + Intronic
1089459375 11:118643831-118643853 GCGGGTCCGGGGAAGGGGGCTGG - Exonic
1089536272 11:119162324-119162346 CAGTGGCTGGGGAAGGGGTAGGG - Exonic
1089538173 11:119173435-119173457 ATGTGTCAGGGAAAGGGGCCTGG - Intronic
1089566427 11:119374146-119374168 TGGTGTCTGGGGAAAGGGTCTGG - Intronic
1090379689 11:126317773-126317795 CTGTGTGTGGAGAAGTGGGGGGG + Intronic
1090442679 11:126737251-126737273 CTGGGGCTCAGGAAGGGGGCAGG + Intronic
1090634802 11:128684256-128684278 CTGGGTGTGGGGGGGGGGGCAGG - Intergenic
1090909225 11:131104066-131104088 CTGTGTCTGTGCAAGGTGGGTGG - Intergenic
1091223457 11:133944423-133944445 CTTTAGCTGGGGCAGGGGGCGGG - Intronic
1091668931 12:2438624-2438646 ATGTGGCTGGGGAACGGGGAGGG + Intronic
1091803752 12:3341816-3341838 CTGCCTCCGGGGAAGGGGACAGG + Intergenic
1091875314 12:3928929-3928951 CTGTATATGGGGAGGTGGGCAGG - Intergenic
1092046630 12:5435536-5435558 TTGTGTATTGGGAAGGGAGCTGG + Intronic
1092560038 12:9603102-9603124 CTGTATCAGTGGAGGGGGGCAGG + Intronic
1092797260 12:12124632-12124654 CTGTGGCTGGGGATGGTGGAGGG + Exonic
1093000298 12:13988628-13988650 CTGTCAGTGGGGAAGGGTGCAGG - Intergenic
1093235570 12:16605446-16605468 CTGTGTTTGGGCATGGGGGCGGG - Intronic
1093434548 12:19121550-19121572 ATGGGTCTGGGGAAGGGCTCAGG + Intergenic
1093524977 12:20095025-20095047 CAGTGTCTGGGTCAGTGGGCAGG + Intergenic
1094043383 12:26141263-26141285 CTGTGTTTGGGGATGGAGGAAGG + Intronic
1094251041 12:28361865-28361887 CTGTGTGTGTGGGAGGGGGGCGG + Intronic
1094754643 12:33453872-33453894 CAGGATCTGGGGAAGGGGGCAGG + Intergenic
1095313795 12:40733487-40733509 CTCTGGCAGGGGAAGGGGGAGGG - Intronic
1095770468 12:45949695-45949717 CTGGGGCTGGGGAAAGGGGTAGG + Intronic
1096106044 12:48997608-48997630 CTGGGTCTTGGAGAGGGGGCAGG - Exonic
1096170476 12:49464889-49464911 CTGTGGCTGGGGTAGGGAGCAGG - Intronic
1096189333 12:49605145-49605167 CTGGGGCCCGGGAAGGGGGCAGG - Intronic
1096255147 12:50058015-50058037 CGGTGGCTGGGGAGGGGGGCGGG + Intronic
1096514450 12:52148358-52148380 CTGTGTGTGTGGGATGGGGCAGG + Intergenic
1096526483 12:52213078-52213100 CTGGGTCTGGAGAAGGGAGGAGG + Intergenic
1097187347 12:57202903-57202925 CTGTGTTTGGGGAGGGGAGCGGG - Intronic
1097417700 12:59333599-59333621 CTCTGTCTGGGGTAGGGGTGGGG - Intergenic
1097769983 12:63572331-63572353 CTCTGCCTGGGGAAAGGGGAAGG + Intronic
1099096490 12:78380292-78380314 TTGTGTTTGGGGAAGGAGGAAGG - Intergenic
1099639948 12:85273782-85273804 CTGTCTCTGGGCGAGGGCGCAGG + Intergenic
1101482061 12:105107775-105107797 CTGTGTCTGTGGGAGGCGCCGGG + Exonic
1101686682 12:107030771-107030793 GTGGGGGTGGGGAAGGGGGCAGG + Intronic
1101998827 12:109544150-109544172 CTGTGTCTGGGAAGGGCTGCAGG - Intergenic
1102470554 12:113157668-113157690 CTGTGTCAGGGCTAGGAGGCAGG - Exonic
1102566985 12:113803324-113803346 CTGGGTCTGGGGAAGGAGAGTGG - Intergenic
1102959695 12:117084709-117084731 CTGAGTCAGGGGAGGGAGGCTGG - Intronic
1103327408 12:120130787-120130809 CTGGCTCTGGGGAAGGGGTGGGG - Intronic
1103739380 12:123081154-123081176 CAGTGTCTGGGCAGGGGAGCAGG + Intronic
1103867497 12:124064492-124064514 CTGTGTTTTGGGAAAGGGGAGGG + Intronic
1103897479 12:124282924-124282946 GAGTGACTGGGGAAGGGGGAGGG + Intronic
1103917063 12:124381217-124381239 CTGTGGCTGGGGCAGCGAGCAGG - Intronic
1103942709 12:124509661-124509683 CAGTGTAGGGGGAAGGGGCCAGG + Intronic
1103991335 12:124801280-124801302 CAGGGGCTGGGGGAGGGGGCGGG + Intronic
1104050005 12:125188554-125188576 CTGTTGCTGGGGGAGAGGGCGGG - Intronic
1104170545 12:126276097-126276119 CTGTATCTGGGGAAGACTGCAGG + Intergenic
1104815880 12:131645102-131645124 CTGGGCCTGGGGCAGGGGCCTGG + Intergenic
1104912777 12:132247694-132247716 CGGTGTCTGGGGACGGGGTGAGG - Intronic
1104963308 12:132498240-132498262 CTGTGTCGGGGGCATGGGGCCGG + Intronic
1105243555 13:18628453-18628475 CGGTGTCCGGGAAAGGGTGCGGG - Intergenic
1105299250 13:19117878-19117900 CTCTGCCTGTGGTAGGGGGCTGG - Intergenic
1105474501 13:20718843-20718865 ATGTGTGTGGGTGAGGGGGCAGG - Intronic
1105859419 13:24395605-24395627 CTGGGCCTGGGGCAGGGGGCAGG - Intergenic
1106395089 13:29371973-29371995 GTGTGTGTGGGGGGGGGGGCGGG - Intronic
1106467035 13:30022707-30022729 CTGAGTCTGGGTCAGGGGACAGG + Intergenic
1107911283 13:45107878-45107900 CTTTGGCTGAGGCAGGGGGCAGG + Intergenic
1108003544 13:45925839-45925861 CTGTGTGTGTGGTAAGGGGCTGG + Intergenic
1108465737 13:50713857-50713879 GTGTGTCTGAGGAGGGAGGCAGG - Intronic
1109358001 13:61257438-61257460 CTGTGTATGTGGGAGGGGGGTGG - Intergenic
1109589000 13:64451452-64451474 GTGTGTTTGGGGCAGGGGGGTGG - Intergenic
1110310041 13:74038221-74038243 CTGTGTCTGAGGAATGGGAGGGG + Intronic
1110479660 13:75959542-75959564 CTGAGTCAGGGGAAGGAGGCTGG + Intergenic
1110527633 13:76557543-76557565 CTGTGTCAGGGGAAAAAGGCAGG - Intergenic
1112280175 13:98056037-98056059 CTGTGGCTGGGCAGGTGGGCAGG + Intergenic
1113575552 13:111392805-111392827 CTGGCTCTGAGGAAGGGGTCAGG + Intergenic
1113633194 13:111901808-111901830 CTCTCCCTGTGGAAGGGGGCAGG + Intergenic
1113849142 13:113408022-113408044 CTGGGTCTGGGGCTGGTGGCTGG + Intergenic
1113955573 13:114098565-114098587 GTGTGTGTGTGGAATGGGGCTGG + Intronic
1114015023 14:18420593-18420615 CAGTGTGTGGGGATGGGGGAGGG - Intergenic
1114231360 14:20785863-20785885 CTGTGGCTGAGGCAGGTGGCTGG + Intergenic
1114487488 14:23071576-23071598 CTGTGTGTGCGGATGGGGGAGGG + Intronic
1114562318 14:23602329-23602351 CTCTGTCAGGGGAGGGGTGCCGG - Intergenic
1115474152 14:33798321-33798343 GTGTGTCTCTGGAAGAGGGCTGG - Intronic
1115474357 14:33799713-33799735 CTCTGTGTGGGGCGGGGGGCCGG - Exonic
1115508881 14:34120343-34120365 CTGAGTTAGGGCAAGGGGGCTGG - Intronic
1115795765 14:36933707-36933729 CTGGGGCTGGAGGAGGGGGCTGG - Intronic
1116448668 14:45039897-45039919 CTGTGGCAGGGGAAGTGCGCTGG - Intronic
1116718251 14:48455831-48455853 CTGTGTGTGGGGATGGGGGGTGG + Intergenic
1117240349 14:53825974-53825996 CTGTCTCTGGGGCAGGGAGAGGG + Intergenic
1117460405 14:55939447-55939469 CTGTGTCGGGGGAGGAGGGCAGG + Intergenic
1118263098 14:64266886-64266908 CTCTGTCTGGGGGCGGGGGGAGG - Intronic
1118638417 14:67769316-67769338 CTCTGTCTGGGGAAGGGCTAAGG + Intronic
1119140758 14:72265364-72265386 CTGTGTCTGAGCCAGGTGGCAGG - Intronic
1119416904 14:74477025-74477047 GTGTGTGTTGGGAATGGGGCTGG - Intronic
1119416916 14:74477104-74477126 GTGTGTGTTGGGAATGGGGCTGG - Intronic
1119572963 14:75692678-75692700 CTGTGTATGGGGAGCGAGGCAGG + Intronic
1119693361 14:76694027-76694049 CTGTGCCTGAGGCAGGGGGCTGG + Intergenic
1119826518 14:77661255-77661277 TAGTGTCTGGTGAAGGGGGCTGG + Intergenic
1119992753 14:79217718-79217740 GTGTTTCTGGGGGAGGGAGCAGG - Intronic
1120429926 14:84400944-84400966 ATGTGTCAGGGGTAGGGAGCAGG + Intergenic
1121288821 14:92757871-92757893 CAGTGTCTGGGGAGGGGAACTGG - Intergenic
1121583634 14:95048350-95048372 CTGAGGCTGGGGGAGAGGGCTGG - Intergenic
1121640332 14:95480991-95481013 CTGTGCCTGGGGTCGGGGGTGGG - Intergenic
1121642805 14:95497141-95497163 CTGTGTGGGGGGACAGGGGCTGG - Intergenic
1122097175 14:99380732-99380754 CTCTGTCTGGGGGAGTGGTCAGG - Intergenic
1122211836 14:100178559-100178581 CTGTGGCTGGGGAAGGGGAGTGG + Intergenic
1122537333 14:102474840-102474862 CTTTGTGTGGGGCAGGGGGAAGG - Intronic
1122602826 14:102929907-102929929 CTGAGGCTGGGGAGGGGGACGGG - Exonic
1122847087 14:104505988-104506010 GTGAGGCTGGGGAAGGAGGCAGG + Intronic
1122847242 14:104506622-104506644 CTGGGCCTGGGGCAGGGGGCAGG - Intronic
1122909229 14:104818834-104818856 CAGTGTCTGGGCAAGTGGGAGGG + Intergenic
1123128757 14:105968800-105968822 CTGTGTTTGGAGAAAGGGGTGGG + Intergenic
1123409283 15:20044963-20044985 CTGTGTTTGGAGAAAGGGGTGGG + Intergenic
1123487744 15:20756178-20756200 CGGTGTCCGGGAAAGGGGGCGGG + Intergenic
1123518614 15:21051671-21051693 CTGTGTTTGGAGAAAGGGGTGGG + Intergenic
1123544234 15:21325236-21325258 CGGTGTCCGGGAAAGGGGGCGGG + Intergenic
1123943266 15:25226858-25226880 CTCCGTTTGGGGAAGGGGGTCGG - Intergenic
1124061025 15:26293839-26293861 CTGTGGCTGGGGATGTGGGTGGG + Intergenic
1125397711 15:39268367-39268389 CTGGGTGAGGGGAAGGGGGAGGG + Intergenic
1125453787 15:39836460-39836482 CTGCTTCTGGGGAGGGTGGCAGG - Intronic
1125747879 15:42009567-42009589 CTGAGGCTGGGGAAGTGAGCAGG - Intronic
1126419493 15:48456409-48456431 GTGTGTTGGGGGAAAGGGGCTGG + Intronic
1126437068 15:48646574-48646596 CTGTGTGTGGGGGAGGGCGAGGG - Intergenic
1126615435 15:50574054-50574076 CTGGGGGTGGGGGAGGGGGCGGG + Intronic
1127890217 15:63243684-63243706 CAGAATTTGGGGAAGGGGGCAGG + Intronic
1128012041 15:64306971-64306993 TTGTGGGTGGGGAGGGGGGCGGG + Intronic
1128087437 15:64895743-64895765 CTGGGACTGGGGGTGGGGGCAGG + Intronic
1128317447 15:66670041-66670063 CTGGGTCTGGGGATTGGGGATGG + Intronic
1128703563 15:69821866-69821888 CTGTGTCTGAGGACCGTGGCGGG - Intergenic
1128999257 15:72319461-72319483 CTGTGATCTGGGAAGGGGGCTGG + Intronic
1129170220 15:73803031-73803053 CTGGGCCTGGTGAAGGGTGCTGG - Intergenic
1129655934 15:77525810-77525832 CTGAGTCGGGGGAGGTGGGCAGG + Intergenic
1129749078 15:78047796-78047818 CAGTGTCTGGAGTGGGGGGCAGG + Intronic
1129951876 15:79599302-79599324 CTTTTTTTGGGGAGGGGGGCAGG - Intergenic
1130223273 15:82039215-82039237 TTGATTCTGGGTAAGGGGGCTGG + Intergenic
1130323164 15:82856834-82856856 CTCTGGCTGTGGAAGGGGACAGG + Intronic
1130662968 15:85845150-85845172 ATGTGGCTGGGGGAGGTGGCGGG + Intergenic
1131064450 15:89424862-89424884 CTGGGTTTGGGGCAGGGGGAAGG + Intergenic
1131150486 15:90044423-90044445 CTGAGTGTGAGGAAGGGGGCCGG + Intronic
1131195701 15:90352824-90352846 CTGTGCATGGGGAAAGGGACGGG + Intronic
1202952579 15_KI270727v1_random:52507-52529 GGGTGTCCGGGAAAGGGGGCGGG + Intergenic
1132556006 16:572976-572998 CTGTGTCTGAGGAAGGCGAGCGG + Intronic
1132612589 16:824683-824705 CTGGTCCTGGGGACGGGGGCGGG + Intergenic
1132637294 16:957781-957803 CTGTGTGTCGGGTCGGGGGCAGG - Intronic
1132641428 16:980272-980294 CGGGGTCTGCGGACGGGGGCGGG + Intronic
1132746645 16:1438975-1438997 CTGCGTCTGGGAAGGGGGGCAGG + Intronic
1132910225 16:2306484-2306506 CTGGGTCTGTGGAAGGAGGTGGG - Intronic
1133118275 16:3590589-3590611 CGCTGTCAGGGAAAGGGGGCTGG - Exonic
1133228017 16:4351965-4351987 CAGGGGCTGGGGGAGGGGGCTGG - Intronic
1133255365 16:4513103-4513125 CTTTGTCTGGTGCAGGTGGCAGG - Intronic
1133281980 16:4671760-4671782 CTGTCTCTGGGGAGGCGGGCAGG - Intronic
1133461554 16:5990632-5990654 CGGTGTATGGGGAAGGTGGGTGG + Intergenic
1135080026 16:19426333-19426355 CCGGGTCTGGGAAAGGTGGCAGG - Intronic
1135361008 16:21814746-21814768 TTGTATCTGGGAAAGGAGGCAGG + Intergenic
1135736210 16:24933739-24933761 AAGTGTCAGGGGGAGGGGGCTGG + Intronic
1135843087 16:25894209-25894231 CTGTGTTCTGTGAAGGGGGCAGG + Intronic
1135998858 16:27274475-27274497 CTGCTTCTGAGGAAGGGGCCAGG + Intronic
1136076495 16:27820814-27820836 CGGTGTCTGGGGTTGGAGGCTGG - Intronic
1136086828 16:27891094-27891116 CTGCTTCTGGGGATGGGGGCAGG - Intronic
1136236113 16:28914581-28914603 ACGTCTCTAGGGAAGGGGGCAGG + Exonic
1136584216 16:31173557-31173579 CTGAGTCTGGGGCAGGGGGGTGG - Intergenic
1136871525 16:33812073-33812095 CTGTGTTTGGAGAAAGGGGTGGG - Intergenic
1137292848 16:47063665-47063687 CTGTGCCTGGGAAAGGAAGCAGG - Intergenic
1137770000 16:51008424-51008446 CAGTGTGTGGGGCAGGGGGGAGG + Intergenic
1138198013 16:55068490-55068512 CTGTGTGGGGGGGGGGGGGCAGG - Intergenic
1138458570 16:57134719-57134741 CTGGGTCTGGGTTTGGGGGCGGG + Intronic
1138460165 16:57143300-57143322 CTGTGTGTGGGCATGGTGGCTGG + Intronic
1138496459 16:57412011-57412033 CTGTGGCTTGAGGAGGGGGCAGG + Intronic
1138591529 16:58001738-58001760 CTTTGTCTGGGGTGGGGGGGAGG - Intronic
1139482426 16:67237822-67237844 CTGTTGCTGGGGAAGGGGAAGGG + Intronic
1141618240 16:85222060-85222082 CAGGGCCTGGGGAAGGGGACAGG + Intergenic
1141692967 16:85606897-85606919 CCGAGGCAGGGGAAGGGGGCTGG - Intergenic
1141802657 16:86321684-86321706 CTGCGTGTGGTGAAGGGGGCTGG - Intergenic
1141828681 16:86497750-86497772 CGGGGACGGGGGAAGGGGGCGGG + Intergenic
1142060869 16:88028277-88028299 CTGTGACTGGGGCTGGGGTCAGG + Intronic
1142089192 16:88200967-88200989 CTGTGTGTGGGCGAGAGGGCCGG + Intergenic
1142201260 16:88762141-88762163 CTGTGCCCTGGGAAGGGAGCTGG + Intronic
1142205573 16:88781411-88781433 GCGTGTTTGGGGAAGGGGCCAGG - Intronic
1142205876 16:88782930-88782952 CTGTGTCTGGGGATGGGGCGTGG - Intronic
1142284698 16:89167005-89167027 CTGTGGCTGGGGATGGGGCTGGG - Intergenic
1142347234 16:89561563-89561585 CTGGTTCTGGGGCAGGTGGCCGG + Exonic
1203100647 16_KI270728v1_random:1303985-1304007 CTGTGTTTGGAGAAAGGGGTGGG + Intergenic
1203139869 16_KI270728v1_random:1755661-1755683 CTGTGGCTGGGGAAGAGAGGAGG - Intergenic
1142488291 17:260819-260841 CTGTGCCTGGTGATGGGGGTGGG - Intronic
1142510034 17:387232-387254 CTGGGTCGGGGGAAGGGGAGTGG - Intergenic
1142765016 17:2059797-2059819 CTGGGACTGGGGAGGGAGGCAGG - Intronic
1143042947 17:4052858-4052880 CTTTGTCTCGGGAGGGCGGCGGG + Intronic
1143118725 17:4594674-4594696 CTGTGATTGGGGATGGGGGTAGG + Intronic
1143136799 17:4716655-4716677 CTGTGTCTGGGGTGGGGGTAAGG + Exonic
1143150331 17:4803868-4803890 ATGTGGCTGGGGATGGTGGCGGG - Intergenic
1143250119 17:5517352-5517374 CTGTGTATGTGGGAGGGGGGGGG - Intronic
1143542378 17:7577274-7577296 GTGTGGCTAGGGAAGGGAGCAGG + Intronic
1143594770 17:7907584-7907606 CTGTGGCTGTGGGAGGGGGTAGG - Exonic
1143617861 17:8064275-8064297 ATGGGTCAGGGGAGGGGGGCTGG + Intergenic
1143772109 17:9175430-9175452 CAGTGTCTTGGCAAGAGGGCAGG - Intronic
1144122751 17:12172307-12172329 CTGGGTCGGGGGCAGGGGGATGG - Intergenic
1144388935 17:14775995-14776017 CGGGGGCTGGGGTAGGGGGCAGG - Intergenic
1144503180 17:15807263-15807285 CTGAGTCTTGGGAGGTGGGCTGG + Intergenic
1144649614 17:16999037-16999059 CAGGGGCTGGGGAAGGGGGAAGG - Intergenic
1144743432 17:17597163-17597185 CCGTGTCTGTGGAATGGGGAGGG + Intergenic
1145165361 17:20609978-20610000 CTGAGTCTTGGGAGGTGGGCTGG + Intergenic
1146184720 17:30717366-30717388 CTGTGTGTGGGGAGGGTTGCTGG - Intergenic
1146196007 17:30813748-30813770 CTGGGTGTGGGGAGGGGGGAGGG - Intronic
1146884895 17:36464276-36464298 CTGAGCCTGGGGTTGGGGGCGGG + Intergenic
1147310523 17:39593420-39593442 CTGTGTCCAGGGAAGGGGCAGGG + Intergenic
1147592830 17:41695914-41695936 CAGCGTGTGGGGATGGGGGCAGG - Intergenic
1147605914 17:41773626-41773648 CTGTTGCTGGGGAAGGGGTGTGG - Intronic
1147614474 17:41820090-41820112 CTTTCACTGGGGCAGGGGGCAGG - Intronic
1147743659 17:42682553-42682575 CAGAGGCTGGGGAAGGGGGGAGG + Intronic
1147966337 17:44196230-44196252 GTGTGGGTGGGGAAGGGGGGTGG - Intronic
1148456093 17:47812305-47812327 CAGTGTCTAGGGAGGAGGGCAGG - Intronic
1148464761 17:47858164-47858186 CTGGGGCTGAGGATGGGGGCCGG - Intergenic
1148799375 17:50213751-50213773 CTGGGTCAGGAGGAGGGGGCAGG - Intergenic
1148809424 17:50280557-50280579 CTCTGCCTGGAGAAGGAGGCTGG - Exonic
1148829769 17:50424128-50424150 CTGTGGATGGGGAGGAGGGCTGG - Intergenic
1148898713 17:50858231-50858253 CTGGGTCAGGGGGAGGGGGATGG - Intergenic
1149141815 17:53440274-53440296 CTGTGTATGGTGAGGGGGGATGG - Intergenic
1149387849 17:56159648-56159670 GTGTGTCTTGGAAAGGGGGAGGG - Intronic
1149430456 17:56593157-56593179 CGGTGTTTGGGGAGGGGGGGCGG - Intergenic
1149560533 17:57604955-57604977 TTGTGTGTGGGGAGGGGGGCGGG + Intronic
1149703594 17:58675623-58675645 GTCTGTCTGGGGAAGGGAGATGG - Intronic
1150198296 17:63325053-63325075 CTTTGTGTGGGGTGGGGGGCGGG + Intronic
1150280240 17:63925866-63925888 CTGTGTTCTGGGGAGGGGGCAGG + Intergenic
1150283358 17:63942019-63942041 CTGCCACTGGGGAGGGGGGCCGG + Intronic
1151162335 17:72176031-72176053 ATGTGTTGGGGGAAGGGGGGAGG - Intergenic
1151213458 17:72561549-72561571 CTGTGTCTGGGGAGTCAGGCTGG - Intergenic
1151699376 17:75734837-75734859 GTGCCTCTGGGGAAGGAGGCAGG + Intronic
1151965278 17:77427937-77427959 CTGGGCCTGGGGAGGGGCGCTGG - Intronic
1152103699 17:78316814-78316836 CTGTGCCTGGGTCATGGGGCTGG + Intergenic
1152212443 17:79009618-79009640 CCGTGGCTGGGGCAGGGCGCCGG + Intronic
1152281356 17:79386603-79386625 CTGACTCTGGGGAAGGTGTCTGG - Intronic
1152565858 17:81100137-81100159 CTGGGGCTGGGGCAGGGGCCTGG - Intronic
1152710371 17:81868187-81868209 CCCTGTCCAGGGAAGGGGGCAGG + Exonic
1152750455 17:82060164-82060186 CTGAGTCTGGGTGAGGGGCCAGG + Intronic
1152791404 17:82282386-82282408 CTGGGTCTGGGGCAGGGGGTAGG - Intergenic
1153052042 18:908693-908715 CTGTTTCTGGGGGAGGGGAAAGG + Intronic
1153291593 18:3507018-3507040 GTGTGTATGGGGCAGGGGGTGGG + Intronic
1153348752 18:4056132-4056154 TTATCTATGGGGAAGGGGGCAGG + Intronic
1153457678 18:5296956-5296978 CTGTGTCTGGCGTCGGGAGCTGG + Intronic
1154445382 18:14431428-14431450 CGGTGTCCGGGAAAGGGTGCTGG + Intergenic
1155282194 18:24251017-24251039 CTGTGCCTGTGGAAAGGGGAGGG + Intronic
1155333143 18:24738137-24738159 GTGTGTGTGGGGGTGGGGGCTGG + Intergenic
1155838230 18:30613764-30613786 CTGTGTCAGGGGCATGAGGCTGG - Intergenic
1156641090 18:39099798-39099820 CTGTGTCTCTGGCAGGGGACAGG + Intergenic
1157314967 18:46579484-46579506 CTCACTCTGGGTAAGGGGGCGGG - Intronic
1157525526 18:48377393-48377415 CTCTGCTTGGGGAAGGGGGTGGG + Intronic
1158481217 18:57823644-57823666 CTCTGCCTGGGGAAAGGGGAGGG - Intergenic
1158920434 18:62186563-62186585 CTGTGGGTGGGGACGGGGGCTGG - Intronic
1160106388 18:75982333-75982355 ATGTGCCTGAGGAAGGCGGCTGG - Intergenic
1160404823 18:78638146-78638168 CTGGGGCTGGGGAGGGCGGCTGG + Intergenic
1160417499 18:78721361-78721383 CTGTTCCTGGGGAGGGGGGGAGG + Intergenic
1160495973 18:79375635-79375657 CTGAGTGAGGGGAAGGGGCCGGG + Intronic
1160603631 18:80033434-80033456 CTGACTCTGGGGAGGCGGGCGGG + Intronic
1160626443 18:80210890-80210912 GTGTGTTTGGGGATGGGGGGTGG - Intronic
1160835442 19:1122629-1122651 CCCTGCCTGGGGCAGGGGGCGGG - Intronic
1160900753 19:1426961-1426983 CTCTGGCTGGGGTAGAGGGCAGG - Intronic
1160939182 19:1612154-1612176 CTGGGTGTGGGGAAGGGAGAGGG + Intronic
1160990025 19:1856695-1856717 CTCAGTCTGGGGACGGGGTCTGG + Intronic
1161202897 19:3025668-3025690 GTGTGGGTGGGGAAGGGGGCGGG + Intronic
1161444733 19:4311785-4311807 CTGTGCCTGGTTCAGGGGGCAGG - Intronic
1161447478 19:4326769-4326791 GTGTGTGTGGGGGAGGGGGCGGG - Intronic
1161457351 19:4376157-4376179 CTGTGTCTCAGGAAGGGCTCTGG - Intronic
1161652729 19:5495258-5495280 CGGTGTCTGGGGCCGGGAGCAGG + Intergenic
1161874277 19:6895576-6895598 GCAGGTCTGGGGAAGGGGGCCGG - Intronic
1162466973 19:10848304-10848326 GTGTGTTTGGGGAAGGGGTGGGG + Intronic
1162788840 19:13052777-13052799 CTGTGTGTGTGGACGGGTGCAGG - Intronic
1162974063 19:14198327-14198349 CTGTGTGTGGGGAGGGTTGCTGG + Intronic
1163035005 19:14565002-14565024 CTGGGTGTGGGGACGGGGTCGGG + Intronic
1163262245 19:16198218-16198240 CTGTTTCTGGGTAACCGGGCGGG + Intronic
1163456011 19:17406022-17406044 CTGGGTCTGGGGGCGGGGCCTGG + Intronic
1163628678 19:18405244-18405266 AGGTGGCTGGGGAAGGGGGAGGG - Intergenic
1163633411 19:18428036-18428058 CTGTGGCTGGGGAGGTGGGGTGG + Intronic
1163633876 19:18429646-18429668 TTGTGTTTGCGGGAGGGGGCGGG + Intronic
1163799117 19:19354459-19354481 CTGGGGCTGGGGAAGAGGGGTGG - Intronic
1164394295 19:27850366-27850388 GTGTGTGTGGGGAAGGGGTGTGG + Intergenic
1165101970 19:33444426-33444448 CTGTGTCCCGGTAAGGGGCCAGG + Intronic
1165434222 19:35787745-35787767 CTGGGGCTGGGGAACTGGGCTGG - Exonic
1165448537 19:35869552-35869574 CGGTGCTTGGGGGAGGGGGCTGG + Intronic
1165476237 19:36032573-36032595 CTGGGCCTGGGGGAGGTGGCAGG - Intronic
1165735697 19:38174078-38174100 CTGAGGCTGGGGAAGGATGCAGG + Intronic
1165749367 19:38250981-38251003 CTGGGACTGGGGATGGGGGTGGG + Intronic
1165834244 19:38744505-38744527 GTGGGGCTGGGGAAGGAGGCGGG + Intronic
1166117922 19:40667193-40667215 CTGTGTCTGGGGTTGGGGAAGGG + Exonic
1166257244 19:41615297-41615319 CTGTGTCTGGGAGGGGGAGCTGG + Intronic
1166300045 19:41908081-41908103 CTGGGGCTGGGGAAGGAGACTGG + Intronic
1166409500 19:42547167-42547189 CTGTGTCTGGGGGAAGGGGCTGG + Intronic
1166705459 19:44905729-44905751 CTATCCCTGGGGGAGGGGGCGGG + Intergenic
1166776815 19:45318064-45318086 ATGTGTGTCGGGATGGGGGCGGG + Intronic
1166874216 19:45887207-45887229 CTGTCTTTGGGGAAGGGCGGAGG + Intergenic
1167208930 19:48121237-48121259 CTGGGCCGGGGGAAGCGGGCCGG - Exonic
1167248637 19:48389783-48389805 CTGCGTCTGAGGGAGGGGCCTGG - Intronic
1167249323 19:48392142-48392164 CTGGGTCTGAGGGAGGAGGCTGG - Intergenic
1167249336 19:48392177-48392199 CTGGGTCTGAGGGAGGAGGCTGG - Intergenic
1167276689 19:48544036-48544058 CTGGGTCTGAGGGAGGAGGCTGG - Intergenic
1167276740 19:48544182-48544204 CTGGGTCTGAGGGAGGAGGCTGG - Intergenic
1167509485 19:49888537-49888559 CTGTGTCCGTGGAGGGCGGCGGG - Exonic
1167608856 19:50496623-50496645 CTCTGCCTGGGGAAGGGGACAGG - Intergenic
1167713584 19:51126526-51126548 TTGGTTCTGGGGAGGGGGGCAGG - Intronic
1167740063 19:51319143-51319165 GTGTGTCTGGGGGATAGGGCAGG + Intronic
1167758258 19:51426743-51426765 CTGAGTCTGGGGGAAGGCGCAGG - Intergenic
1167774195 19:51544199-51544221 CGGATTCTGGGGAAGGGGACGGG + Intergenic
1167898156 19:52598408-52598430 CTCTGTCTGGGGCAGGGTGGGGG + Intronic
1168145183 19:54416379-54416401 GTGTCCCTGGGGAAGGGGCCCGG + Intronic
1168252376 19:55147948-55147970 TTGGGTCTGAGGGAGGGGGCCGG + Intronic
1168295928 19:55377331-55377353 CTGGGTCTGAAGGAGGGGGCTGG + Intronic
1168295954 19:55377400-55377422 CTGGGTCTGAAGGAGGGGGCTGG + Intronic
1168338934 19:55612978-55613000 CTGTGGGTGGGGTAGGGTGCAGG + Intronic
1168422280 19:56212417-56212439 CTGTGTCTGGAGAAGGATGTTGG - Intergenic
1168509788 19:56965378-56965400 CAGGGGCTGGGGAAGGGGGACGG - Intergenic
1202714819 1_KI270714v1_random:36356-36378 CTGTGTCTAGGGAGTGGGGAGGG - Intergenic
925134261 2:1515377-1515399 CTGCGTCTGTGAAAGGTGGCAGG + Intronic
925230669 2:2231007-2231029 CTGAGTCTGGGGGTGGGGGCTGG - Intronic
926047977 2:9724246-9724268 CTGTGTCTTGGGAAGGAGCATGG - Intergenic
926204721 2:10828014-10828036 CTGTGTGTGTGGCAGGGGGAGGG - Intronic
926216889 2:10911516-10911538 CTGGGTCGGGGGGATGGGGCAGG + Intergenic
926644500 2:15274560-15274582 CGGTGTCTAGGTGAGGGGGCAGG + Intronic
926737236 2:16082886-16082908 CACTGTCTGGGCAAGAGGGCAGG + Intergenic
927153476 2:20208930-20208952 CTGTGGGTGGGGAAGGGGCAAGG - Intronic
927275527 2:21259272-21259294 GTGTGTGTCGGGAAGGGGGGAGG + Intergenic
927459714 2:23287520-23287542 CTCTGTCTGGGAAAGGTGCCAGG - Intergenic
927683903 2:25157914-25157936 CTGTGTATGGGAAAGGGGGCTGG - Exonic
928275682 2:29898149-29898171 CTGGGGCTGGGGAAGGTGGCAGG - Intronic
928315015 2:30238158-30238180 CTCTGTCTGGGGAAGGGTCTTGG + Intronic
928624115 2:33122026-33122048 ATGTGTGTGTGGAGGGGGGCAGG - Intronic
929508423 2:42547094-42547116 CTGTCTCTGGGGGAGGGGCCAGG - Intronic
929539315 2:42808292-42808314 CTGCACCTGGTGAAGGGGGCAGG - Intergenic
929748812 2:44688708-44688730 TTCTGTGTGGGGAAGGGGGAAGG - Intronic
930091499 2:47534518-47534540 CTGTGTGTGGGGGCGGGGGGGGG - Intronic
930944829 2:57061297-57061319 CTGTGCCTGTGGAAAGGGGAGGG - Intergenic
930946144 2:57078371-57078393 CTGTGTAAGGAGAGGGGGGCGGG - Intergenic
931102892 2:59022142-59022164 CTCTGTCTGAGGATAGGGGCAGG + Intergenic
932280978 2:70491629-70491651 CTGTCTCCGGGGAAGGGGCATGG - Intronic
932288978 2:70559371-70559393 CTGAGTCTGGGGTTGGGGGCGGG - Intergenic
932404358 2:71503679-71503701 CTGAATCTGGAGAAGAGGGCTGG - Intronic
932624240 2:73284822-73284844 CTGTGAATCCGGAAGGGGGCGGG + Intergenic
932751324 2:74373498-74373520 CTGGTTCTGGGGAAGGGGGTTGG - Intronic
932837402 2:75050453-75050475 CTCTGGATGGGGAAGGAGGCGGG - Intronic
933694862 2:85210235-85210257 ATGTGTGTGGGGAAGGGGCCAGG - Intronic
933695326 2:85213140-85213162 CTGTGGCTGGGGTGGGGGGAGGG + Intronic
933708069 2:85306101-85306123 TTGTCTCTGGGGAGGGGCGCGGG - Intronic
933779754 2:85793205-85793227 CGGTTTCTTGGGGAGGGGGCAGG - Intergenic
933943982 2:87268373-87268395 CTGAGTCTGGAGAATGGGACTGG + Intergenic
934177843 2:89592879-89592901 CTGTCTCTGGGGAGAGGAGCAGG - Intergenic
934288141 2:91667180-91667202 CTGTCTCTGGGGAGAGGAGCAGG - Intergenic
934781216 2:96970950-96970972 CTGGGGGTGGGGATGGGGGCAGG - Intronic
935734479 2:106095958-106095980 GTGTGTCTACTGAAGGGGGCAGG - Intronic
936097832 2:109547050-109547072 CCCTGGTTGGGGAAGGGGGCTGG - Intronic
936336238 2:111593206-111593228 CTGAGTCTGGAGAATGGGACTGG - Intergenic
936572609 2:113628881-113628903 GTGTGTCGGGTGGAGGGGGCAGG + Intronic
936574359 2:113641185-113641207 CTGTGTCTTGGAAAGAGGGCAGG - Intronic
936949717 2:117965756-117965778 CAGTGTCAGGTGTAGGGGGCAGG - Intronic
937227546 2:120378442-120378464 CTCTGACTGGGGTAGGGGGTAGG + Intergenic
937338672 2:121077184-121077206 CTGTGGCCGCGGAAGGGGCCGGG + Intergenic
937350345 2:121156534-121156556 CTCTTGGTGGGGAAGGGGGCCGG - Intergenic
937628388 2:124069249-124069271 CTCTGACTGTGGAAGGGGGAAGG + Intronic
937694426 2:124791994-124792016 CTGCCTCTGGGGAATGTGGCCGG + Intronic
938058857 2:128236656-128236678 CGGTGTCTGGGGAGAGGGCCTGG + Intergenic
938562789 2:132489410-132489432 CTGTGACTGGGGCTGGCGGCAGG + Intronic
938573785 2:132585549-132585571 CTGTGTGTGCGGACGGGGCCTGG + Intronic
939172213 2:138709439-138709461 CTGTGGGTAGGGAGGGGGGCAGG - Intronic
939498574 2:142952155-142952177 TTGAGCCTGGGGAAGGTGGCGGG - Intronic
941528197 2:166631999-166632021 CTCTGCCTGGGGAAAGGGGAGGG - Intergenic
941933254 2:170963486-170963508 CTGGGGCGGGGGAGGGGGGCGGG - Intronic
941934218 2:170970722-170970744 CTGAGTCTGGGGAGAGGGGAGGG + Intergenic
942462562 2:176178344-176178366 GTGTGTCTAGGGTTGGGGGCAGG + Intergenic
942858863 2:180585761-180585783 CTGGGGTTGGGGAAGGGGGGAGG - Intergenic
942889133 2:180965537-180965559 CTGTGTCAGGGGGTGGGGGTAGG + Intergenic
942986426 2:182148268-182148290 CTGTGTGTGTGGAGGGGGGTGGG + Intronic
943657973 2:190529335-190529357 CTGTGGCTGGAGCAGTGGGCTGG - Intronic
944314848 2:198273177-198273199 CTGTGTCTGCGGAGGCGGGATGG + Intronic
946149366 2:217753769-217753791 CAGTAACTGGAGAAGGGGGCAGG + Intronic
946177080 2:217928584-217928606 CTGGGTTTGGGGAAAGGGCCAGG - Intronic
946412722 2:219523016-219523038 CTGTGTGTGCGGGAGAGGGCGGG + Intronic
947446132 2:230163939-230163961 CTGTATCTTGGGCAGGGGGTGGG - Intergenic
947536129 2:230941412-230941434 CTGGGTCTGGGAGCGGGGGCAGG - Intronic
947538197 2:230954221-230954243 CTGTGTCAGGGGAAGGGGCAAGG - Intronic
947864450 2:233386539-233386561 CTGTCTCTAGGGGAGGGGGTGGG + Intronic
947935642 2:234001238-234001260 CTGCTTCTGGGGAGAGGGGCAGG + Intronic
948190193 2:236052308-236052330 GTGTGTTTGGGGGTGGGGGCAGG - Intronic
948575536 2:238947185-238947207 CTGTGCCTGGGGCAGGGGCGGGG + Intergenic
948789514 2:240370086-240370108 CTGTGTCTGGGGGAGGAGGGTGG + Intergenic
948945051 2:241215151-241215173 CTTTGGCTGGGGAGGGGGTCTGG + Intronic
1168910003 20:1440110-1440132 ATGTGTCTGGGGTAGGAAGCGGG - Intergenic
1169227317 20:3864817-3864839 CTGTCCCGGGGGAAGGGGCCAGG - Intronic
1169569918 20:6894979-6895001 CTGTGTCTGGGGGTGGGGAGGGG + Intergenic
1170446550 20:16433954-16433976 CTGTGTCTGGAGTTGGGGGAGGG - Intronic
1170747229 20:19111071-19111093 GTGTGTGTGGGGAGGGGGGAGGG + Intergenic
1170756672 20:19212063-19212085 CTGTGCCAGGGGAAGAGGGACGG - Intergenic
1170970008 20:21106537-21106559 GTGTGTCTGGGTTTGGGGGCTGG + Intergenic
1171190107 20:23152716-23152738 CTGTGCTTGGAGAAGGTGGCTGG - Intergenic
1171232495 20:23498855-23498877 CTGTGTCTGGGGTAGAGGGACGG - Intergenic
1171244457 20:23600212-23600234 CAGTGTCTTGGGAAGTGGGGTGG - Intergenic
1171473472 20:25390317-25390339 CGGTGCCTGGGGAAGGGAGCGGG + Intronic
1172186604 20:33034923-33034945 CTGTGGCTGGGGAGGAAGGCCGG + Intronic
1172328653 20:34058076-34058098 CTTTTTGAGGGGAAGGGGGCCGG + Intronic
1172488773 20:35317231-35317253 CTGTGTGTAGGAAAGGGGCCGGG - Intronic
1172638211 20:36424160-36424182 CTGTGACAGGTGAAGGGGACAGG + Intronic
1172841723 20:37906039-37906061 CTGTGTCTGGGGGTGGGGGGTGG + Intronic
1172966934 20:38842690-38842712 CTGTGCCTGGGGGTGGGGGAGGG - Intronic
1173290724 20:41712685-41712707 CTGTGTTTAGGGAAGCAGGCTGG - Intergenic
1173402355 20:42736747-42736769 CCTTGGCAGGGGAAGGGGGCAGG + Intronic
1173549815 20:43924863-43924885 CTGTGTGTGGAGAAGGGAGAGGG - Intronic
1173586748 20:44188002-44188024 CTGGGTCTGCGGCAGGGGGCAGG - Intergenic
1173911518 20:46674353-46674375 CTCACTATGGGGAAGGGGGCAGG + Intronic
1174038398 20:47682433-47682455 CTGCGTCTGGGGCAGGGGAGCGG - Intronic
1174102821 20:48140095-48140117 CTGTGGCTGGGGAGGAGGTCTGG - Intergenic
1174397330 20:50255469-50255491 AGGGGTCTGTGGAAGGGGGCAGG - Intergenic
1174490350 20:50888868-50888890 GGGTGTCGGGGGAAGGGGGTGGG - Intergenic
1174672892 20:52324371-52324393 CTGTGACTTGGGATGGGGTCAGG + Intergenic
1174710647 20:52701346-52701368 GTGGGTCTGGGGATGGGGCCTGG + Intergenic
1174907860 20:54571620-54571642 GTATCTCTGGGGAAGGGGGGTGG + Intronic
1175100455 20:56575387-56575409 CTGGGTCCGAGGAAGGAGGCAGG - Intergenic
1175378841 20:58548807-58548829 CAGTGTTTGGGGGAGGGGGTTGG - Intergenic
1175403054 20:58711439-58711461 CTGTGTCAGGGACACGGGGCAGG - Intronic
1175687456 20:61041805-61041827 CTGTGGCTGGGCAAGTGGGCTGG + Intergenic
1175831770 20:61968571-61968593 CTGGGGCTGGGGAAGGGCGCAGG - Intronic
1175936792 20:62517813-62517835 CTGTGTTTGGGGCATGGGGGAGG - Intergenic
1175940121 20:62533909-62533931 CAGTGTCTGTGGGTGGGGGCAGG + Intergenic
1176058745 20:63162555-63162577 CTCTGTCTGGGGTAGGGGGTGGG - Intergenic
1176303180 21:5108583-5108605 ATGTGGCTGGGGAAGGGGTGTGG - Intergenic
1176382847 21:6121741-6121763 GCGTGTCTGGGGGCGGGGGCAGG + Exonic
1176389183 21:6154907-6154929 CTGGGGAGGGGGAAGGGGGCAGG - Intergenic
1176450597 21:6858431-6858453 CGGTGTCCGGGGAAGGGGGCGGG - Intergenic
1176828767 21:13723449-13723471 CGGTGTCCGGGGAAGGGGGCGGG - Intergenic
1176940286 21:14915634-14915656 CTGTGTGTGTGGATGGGGGTGGG + Intergenic
1177676487 21:24307856-24307878 CTGCTTCTGGGGAAGGCTGCAGG + Intergenic
1177713863 21:24814201-24814223 CTGTGCCTGGCCAACGGGGCTGG - Intergenic
1178225420 21:30711477-30711499 CAGTGTCTGAGGAAGGGCACTGG + Intergenic
1178437970 21:32576006-32576028 CTGTGTGTGGGGTGGAGGGCTGG + Intergenic
1178439290 21:32585251-32585273 ATGTTTCTGCGGAAGTGGGCTGG + Intronic
1178696622 21:34798202-34798224 GTGTGTTGGGGGAACGGGGCGGG - Intronic
1178710918 21:34916030-34916052 GTGTGTGTGGGGAAGGGGAGAGG + Intronic
1179104094 21:38383271-38383293 CTGGGGCTGGGGAAGGAAGCCGG - Exonic
1179449650 21:41459840-41459862 CTGTGGCTGGGGGAGCGGTCTGG + Intergenic
1179505531 21:41837524-41837546 CAGGGGCTGGGGGAGGGGGCTGG + Intronic
1179511479 21:41876894-41876916 CTGTGTGTGGGGAATGGAGCTGG - Intronic
1179587755 21:42384495-42384517 CTGTGTGTGGGGGTGGGGGTAGG - Intronic
1179715082 21:43282279-43282301 CTGTGGCTGGGGCAAGGGCCAGG - Intergenic
1179734289 21:43383341-43383363 CTGGGGAGGGGGAAGGGGGCAGG + Intergenic
1179740622 21:43416498-43416520 GCGTGTCTGGGGGCGGGGGCAGG - Exonic
1179853845 21:44153341-44153363 ATGTGGCTGGGGAAGGGGTGTGG + Intergenic
1179934376 21:44592882-44592904 CTGTGTCCGGTGATGGGGGAAGG - Intronic
1180001104 21:44995947-44995969 CTGAGGCTGGGAAAGGAGGCAGG - Intergenic
1180394181 22:12314402-12314424 GTGGGTTAGGGGAAGGGGGCAGG - Intergenic
1180405565 22:12550347-12550369 GTGGGTTAGGGGAAGGGGGCAGG + Intergenic
1180439523 22:15351370-15351392 CAGTGTGTGGGGATGGGGGAGGG - Intergenic
1181005932 22:20013515-20013537 AGGTGTCTGGGGAAGGGTCCTGG + Intronic
1181033199 22:20157944-20157966 CTTGGTCTGGGGAGGAGGGCTGG + Intergenic
1181100003 22:20532663-20532685 CTCTAGCTGAGGAAGGGGGCTGG - Intronic
1181510109 22:23385288-23385310 CTTGGTCTGGGGAGGAGGGCTGG - Intergenic
1181648700 22:24247311-24247333 CTGTGCCTGGAGGAGGGAGCAGG + Intergenic
1181690612 22:24557308-24557330 GTGTGTCAGGGGAGGGGGACTGG - Intronic
1181967413 22:26666793-26666815 CTGGGCCTGGGGAGGGGGCCTGG + Intergenic
1182380386 22:29883089-29883111 CGGTGTCCGGGAAAGGGGGCGGG - Intergenic
1182418366 22:30236018-30236040 GAGTGTCTGGGGCTGGGGGCGGG - Intergenic
1182436557 22:30334523-30334545 CTGGGTCTGGGGCAGGGGGTGGG + Exonic
1182445313 22:30386584-30386606 ATGTCTATGGGGGAGGGGGCTGG - Intronic
1182548405 22:31088619-31088641 CTGGGGCAGGGGATGGGGGCAGG + Intronic
1182868927 22:33628845-33628867 GTGGGTCTGGGGTGGGGGGCAGG + Intronic
1182970557 22:34570872-34570894 CTGTGGTTGTGGGAGGGGGCTGG - Intergenic
1183238335 22:36637127-36637149 CTTTGTCTTGGGAAGTGGCCTGG + Intronic
1183303653 22:37070647-37070669 CACAGTCTGGGGATGGGGGCAGG + Exonic
1183367180 22:37412938-37412960 CTGTGTCAAGGGAAGGGAGAGGG - Intronic
1183486315 22:38089296-38089318 CTGGGACTGGGGGTGGGGGCTGG - Intronic
1183536345 22:38403797-38403819 TTGTGTCTGGGAATGGGGGTGGG + Intergenic
1183590293 22:38775895-38775917 CTGTCTGTGGGGGACGGGGCAGG + Intronic
1183642524 22:39101159-39101181 ATGTGACTGGGGGCGGGGGCCGG - Intronic
1183960177 22:41406717-41406739 CTCTGTATGGGGAAGAGGGGAGG - Intergenic
1184021961 22:41826928-41826950 CTCTGTCAGTGGTAGGGGGCTGG - Intergenic
1184204900 22:42995889-42995911 TGGAGACTGGGGAAGGGGGCAGG - Intronic
1184288591 22:43486260-43486282 CAGTGTCTGGGGAAGGACTCGGG + Intronic
1184464227 22:44659533-44659555 CTGACTGTGGGGAAGAGGGCAGG - Intergenic
1185225663 22:49650610-49650632 CTGTGTGTGGAGAAGGGTGGAGG + Intronic
1185296169 22:50056389-50056411 CTGCGGGTGGGGACGGGGGCGGG + Intronic
1185302269 22:50088115-50088137 CTGTGTCTTGGGCTGGGTGCTGG - Intergenic
1185359580 22:50397597-50397619 GTGTGACTTGGGATGGGGGCAGG + Intronic
1185359596 22:50397668-50397690 GTGTGACTTGGGATGGGGGCAGG + Intronic
1185359613 22:50397741-50397763 GTGTGACTTGGGATGGGGGCGGG + Intronic
1185359629 22:50397812-50397834 GTGTGACTTGGGATGGGGGCAGG + Intronic
1185359645 22:50397882-50397904 GTGTGACTTGGGATGGGGGCGGG + Intronic
1185359661 22:50397953-50397975 GTGTGACTTGGGATGGGGGCAGG + Intronic
1185425813 22:50769703-50769725 CTGTGTCTTGGAAAGAGGGCAGG + Intronic
1185427581 22:50781998-50782020 GTGTGTCAGGTGGAGGGGGCAGG - Intronic
949238142 3:1836131-1836153 CTTTTTTTGGGGGAGGGGGCGGG + Intergenic
949952217 3:9238689-9238711 CTCTGCCTGGGGAAGGGATCCGG - Intronic
950143003 3:10628094-10628116 GTGTGGCTGGAGCAGGGGGCGGG + Intronic
950545699 3:13636784-13636806 GTGTGTATGAGGAAGAGGGCTGG - Intronic
950798220 3:15528583-15528605 CTGGGATTGGGGTAGGGGGCCGG - Intergenic
951235827 3:20235364-20235386 CTCTGTGTGGGGAAGAGGGTGGG + Intergenic
951494854 3:23315189-23315211 CTCTGCCTGGGGAAAGGGGAGGG - Intronic
952591065 3:34954253-34954275 CTGTGTATGGGGAAGGAGATAGG + Intergenic
952838905 3:37627934-37627956 CTGCCTCTGGGGAAGGGGGCTGG + Intronic
953376428 3:42432065-42432087 CTTGGTCTAGGGAAGGGGGCAGG + Intergenic
953413920 3:42704719-42704741 CTGTGTCTGAGGGGGGTGGCAGG + Intronic
953872481 3:46639270-46639292 ATGTGTTTGGGGATGGGGGTGGG + Intergenic
954097338 3:48338837-48338859 TTGTGACTGAGGAAGTGGGCTGG - Intergenic
954445182 3:50542486-50542508 CTGTGCCTGGGGGAGTGGGGGGG + Intergenic
954614788 3:51964128-51964150 CTGGGGCTGGGGAGGGGGCCTGG - Intronic
954922370 3:54202985-54203007 CTGTGTCTGGGGATCATGGCTGG + Intronic
955101574 3:55854838-55854860 CTGGGGATGGGGAAGGAGGCTGG + Intronic
955295335 3:57729748-57729770 CTGAGTCTGGGGAAGGGTTGTGG + Intergenic
955903229 3:63779405-63779427 CTGTGTCTGAGGCCGGGGGAGGG - Intergenic
956064968 3:65388417-65388439 CTGTCTTGGGGGGAGGGGGCAGG + Intronic
956182112 3:66527284-66527306 CTCTGTATGGGGTGGGGGGCGGG + Intergenic
956286198 3:67613173-67613195 CAGTCTCTGGGGAAGAGAGCGGG - Intronic
956427937 3:69155803-69155825 GTGGGTGTGGGGAAGGGGTCAGG + Intergenic
957148257 3:76452318-76452340 TTGTGTGGGGGGAAGGGGGAGGG - Intronic
957961292 3:87256921-87256943 CAGTGTTTGGGGATGGCGGCGGG - Intergenic
958033390 3:88142013-88142035 GTGTGTGTGGGGAGGGGGGCTGG + Exonic
958151014 3:89695536-89695558 CTGTGTGTAGGGAGAGGGGCAGG - Intergenic
958265643 3:91434319-91434341 GTGACTGTGGGGAAGGGGGCAGG - Intergenic
958744208 3:98113471-98113493 ATGTGTCTTGGGAAGGTGGAGGG - Intergenic
959358974 3:105366813-105366835 CTGCGTCCGGGGAAGTGGGGAGG + Intergenic
959547386 3:107612981-107613003 CTCTGCCTGGGGAAAGGGGAGGG - Intronic
961378690 3:126483259-126483281 CTGGGTGTGGGGATGGGGGCCGG - Intronic
961593102 3:127995584-127995606 CTGCCTCTGAGGAAGGGGCCTGG + Intergenic
961634620 3:128325188-128325210 TTGTTCCTGGGGAAGGGGGAAGG + Intronic
961681472 3:128602955-128602977 CTGCCTCTGGGAAAGGTGGCTGG + Intergenic
962025116 3:131539685-131539707 GTGTGTGTGGGGAAGTGGGGAGG + Intronic
962251571 3:133839180-133839202 CTGTGTCTGGGGCAGGGCTGTGG + Intronic
962345736 3:134617995-134618017 TTGGGTCTGGGGTAGGGGGTGGG + Intronic
962411336 3:135143949-135143971 CTGTGCCTGGAGGAGGAGGCAGG - Intronic
962767641 3:138580117-138580139 CTCTGCCTGGGGAAAGGGGAGGG + Intronic
963541877 3:146601751-146601773 TTGTGTGTGGGGCAGGGGGGTGG + Intronic
963810154 3:149768546-149768568 CTCTGTCTGGGGAGGGGGGATGG - Intronic
963974091 3:151461097-151461119 CTGTGTCTGGGGACGCGGCCGGG + Intergenic
965423130 3:168487388-168487410 CTGTGTCTAGGGTAGTGGGCTGG + Intergenic
965741580 3:171880737-171880759 CTGTGCCTCAGTAAGGGGGCAGG + Intronic
967126347 3:186427868-186427890 CTGCAGCTGGGGAAGGGGGCAGG + Intergenic
967381434 3:188863516-188863538 CAGTGTCAGGAGGAGGGGGCTGG - Intronic
968075957 3:195816262-195816284 CTGTGTAAGGAGAAGGAGGCCGG - Intergenic
968076144 3:195816953-195816975 CTGTGTAAGGAGAAGGAGGCCGG - Intergenic
968444818 4:646669-646691 GCGTGTCTGAGGAAGGGGGCCGG - Intronic
968470922 4:781982-782004 CCGGGCCTGGGGAAGGGAGCGGG - Intergenic
968586199 4:1417200-1417222 CTGTCTCTGGGCATGGTGGCCGG + Intergenic
968614816 4:1572653-1572675 CTTGGTCGGGGGAAGGGGGCTGG + Intergenic
968686577 4:1963432-1963454 TTGTATCTGGGGAGGAGGGCAGG + Intronic
969202657 4:5618134-5618156 CTGTGGCTGGAGGAGGGGGCAGG + Intronic
969351982 4:6603379-6603401 CTGTGTCCTGGGATGGGGCCTGG - Intronic
969414311 4:7048739-7048761 CAGGGACTGGGGAAGGGGGAGGG - Intronic
969449088 4:7262838-7262860 CTGTGTCTGGTGAAGGTGGAGGG + Intronic
969470862 4:7388546-7388568 CTGTGGGTGGGGAAGCGGGGAGG - Intronic
969482996 4:7456765-7456787 CTGTGGCAGGGGTAGGGGGGTGG + Intronic
969542692 4:7803535-7803557 CTGTGGTTGGGGATCGGGGCCGG - Intronic
969657726 4:8507788-8507810 CTGTCACTGGGGGACGGGGCAGG - Intergenic
969716370 4:8870215-8870237 CTGTGTTGGGGGTGGGGGGCTGG + Intronic
970431100 4:15989944-15989966 CTGTGAGTGGGCATGGGGGCTGG + Intronic
970671258 4:18398987-18399009 TTTTGTCTTGGGAAAGGGGCGGG - Intergenic
971713002 4:30141323-30141345 GTGTGTGTGGGGCAGGGGGCAGG + Intergenic
972290613 4:37686714-37686736 CTGTGGGTGGGGAAAAGGGCGGG - Intergenic
972715434 4:41641258-41641280 GTGTGTCTGGGGATGGGGGTTGG - Intronic
972745503 4:41928279-41928301 GTGTGTGTGGGGATGGGGGTGGG + Intergenic
975563017 4:75724904-75724926 CTGGGACTTGGGAAGGGGTCCGG + Intronic
975613162 4:76221154-76221176 TTGTGGCAGGGGAAGGGGACAGG + Intronic
975835055 4:78413876-78413898 CTCTGTCTGGGGAGGGGAGAGGG + Intronic
976401832 4:84615578-84615600 CTGTGGCAGGGGGAGGGGGTGGG - Intronic
976441136 4:85076075-85076097 CTGTGTGTTGGGTGGGGGGCAGG - Intergenic
976470568 4:85423978-85424000 CTGTGTGTGTGGAAGGGGGGCGG + Intergenic
977320706 4:95512070-95512092 ATGGGTCTGGAGAAGGAGGCAGG + Intronic
978560739 4:110031035-110031057 GTGTGTGTGTGGGAGGGGGCTGG + Intergenic
978583700 4:110256578-110256600 CTGTGTCTGGGGAGGGCTGCAGG + Intergenic
979238095 4:118424201-118424223 CTGAGTCTGGGGAAGGGAGCTGG - Intergenic
979528788 4:121745815-121745837 GTGGGTCAGGGGAAGGGGGGAGG - Intergenic
979986964 4:127327128-127327150 TTGTGTGTGGGGAGGGGGGAGGG + Intergenic
980524818 4:133976105-133976127 CTCTGTTGGGGGAAGGTGGCAGG - Intergenic
981183391 4:141772352-141772374 CTGTGTGTGGGGGTGGGGGGAGG - Intergenic
981923464 4:150112815-150112837 CTCTGTCCGGGGCGGGGGGCGGG - Intronic
981969183 4:150645886-150645908 CTTTTTCTTGGGAGGGGGGCGGG - Intronic
982455409 4:155603706-155603728 CAGTGTGTGGGGCAGGGGGACGG + Intergenic
983467429 4:168112289-168112311 CTCTGTCTGGGGTGGCGGGCTGG + Intronic
983930992 4:173453204-173453226 CTGTCTCTGGAGAAAAGGGCAGG - Intergenic
984490768 4:180431765-180431787 CTGTGGCGGGGGAACGGGGCAGG + Intergenic
984594643 4:181653854-181653876 CTGGGTCGGGGGAAAGGGGAGGG - Intergenic
984852564 4:184167041-184167063 CTGTGCCTGGGGCAGGGGTTGGG + Intronic
984991535 4:185385892-185385914 CTCTGTCTCGGGGAGGGGGGGGG + Intronic
985519425 5:366064-366086 GTGTGTGTGGGGCAGGGGGTGGG - Intronic
985565237 5:612211-612233 GCGTGGCTGGGGGAGGGGGCGGG - Intergenic
985640145 5:1059752-1059774 CTGTGTCGGGGGGTGGGGGGTGG + Intronic
985708459 5:1414895-1414917 CTGTGTCTGGGGAAGGGGGCGGG + Intronic
985771140 5:1812143-1812165 CTGTGTCTGGTGAGGGTGGAAGG + Intronic
986748091 5:10761379-10761401 CTGTGGCCGGGGGCGGGGGCGGG + Intergenic
987101442 5:14594630-14594652 AGGGGTCTGGGGAAGGGAGCGGG + Intronic
987264952 5:16243675-16243697 GTGTGTGTGGGGGTGGGGGCAGG - Intergenic
987940612 5:24531198-24531220 TGGTGACTGGGGAAGGGGGAAGG - Intronic
988526381 5:31990862-31990884 CAGTGTCATGGGCAGGGGGCTGG + Intronic
988798324 5:34673306-34673328 CTGTGTGAGGGCAATGGGGCAGG + Intronic
989146719 5:38257755-38257777 CTGGGCCTGGGGCAGGGGGCCGG - Intergenic
989164922 5:38424420-38424442 CTCTGTCTGGGGTAGGGAGCAGG - Intronic
989191085 5:38670457-38670479 CTGTCTCTGGGGGAGGGGAGAGG - Intergenic
989466684 5:41764779-41764801 CTGTGGCTGGGAAAGCAGGCAGG + Intronic
989698174 5:44229361-44229383 ATGTGTTTGTGGAAGAGGGCAGG - Intergenic
990168152 5:53017920-53017942 CTGTGGCTGGGGGAGGCTGCAGG + Intronic
990888734 5:60624892-60624914 CTGTGTGGGGGGTCGGGGGCAGG - Intronic
990951747 5:61305243-61305265 GTGTGTGTGGGGGGGGGGGCGGG + Intergenic
991137038 5:63194037-63194059 CTGTGTCTATGGTAGTGGGCAGG - Intergenic
992365094 5:76083125-76083147 GTGGGACTGGGGCAGGGGGCGGG - Intergenic
992503290 5:77362701-77362723 GTGTGACTTGGGAAGGTGGCAGG - Intronic
992610659 5:78505453-78505475 GTGTGTCAGGGGAAGGGGAGGGG + Intronic
992918050 5:81479956-81479978 CTGGGGCTGGTGAAGGGTGCTGG - Intronic
993384700 5:87251061-87251083 CTGTGTGGGGGGATGGGGGGTGG - Intergenic
993518076 5:88862748-88862770 CTGTGTCTAGGAAATAGGGCAGG + Intronic
993633645 5:90317943-90317965 CTGTCACTGGGGAAGGGGGGTGG + Intergenic
994087004 5:95770001-95770023 CAGTGTTTGGAGAAGGGGGTAGG + Intronic
994852676 5:105075788-105075810 CTTTGCCTGGGGAAGGAGCCTGG - Intergenic
995039361 5:107570643-107570665 GTGTGTGTGGGGGTGGGGGCGGG + Intronic
995507853 5:112879318-112879340 ATGTGTTTGGGGGGGGGGGCTGG + Intronic
995685440 5:114766806-114766828 CCTTGGCTGGGGATGGGGGCGGG + Intergenic
997111413 5:131078969-131078991 CTCTGGCAGGGGATGGGGGCAGG - Intergenic
997335487 5:133106154-133106176 GTGTGTGTGGGGAAGGGTGTGGG + Exonic
997382788 5:133449487-133449509 CTGTGGCTGGGGTTGGGGCCTGG + Intronic
997524793 5:134545228-134545250 CTTTCTCTGGGGTGGGGGGCAGG + Intronic
997659145 5:135576747-135576769 CTGAGGCTGGGGGTGGGGGCAGG - Intronic
997860187 5:137409002-137409024 GTGTGTTTGGGGAAGGGGTTTGG - Intronic
997884141 5:137615530-137615552 CTGCCTCTGGGGAGGGGGGGCGG - Intergenic
998005100 5:138651525-138651547 GTGTGTGTGGGGGTGGGGGCAGG - Intronic
998133742 5:139664063-139664085 CTGGGCATGGGGGAGGGGGCTGG - Intronic
998501506 5:142636835-142636857 CTGTGGCTGGGGAAGCTGGCAGG + Intronic
998660764 5:144234840-144234862 TTTTGTCTGTGGAAGGGGGCAGG - Intronic
999276423 5:150333685-150333707 CTGTGTGGGGTGAAGGGAGCAGG - Intronic
999499881 5:152136234-152136256 CTGTGTTTGGGGAATGTGGGTGG - Intergenic
999754608 5:154655062-154655084 CTGGGTCTGGGTGTGGGGGCAGG - Intergenic
1000014823 5:157267011-157267033 CTCTGCTTGGGGATGGGGGCAGG + Intronic
1000090025 5:157922251-157922273 CTGTGTCTGGCGAAAGGGATAGG + Intergenic
1000326338 5:160175493-160175515 CTGACTCTGGGAAAGCGGGCAGG - Intergenic
1000792421 5:165624206-165624228 TTGTGTCTGGGGTGGGGAGCAGG + Intergenic
1000873861 5:166611212-166611234 CTGTGTATGTGGTTGGGGGCGGG - Intergenic
1001084697 5:168692115-168692137 CTGTTGCAGGGGAAGGGGGCAGG - Intronic
1001110054 5:168888227-168888249 CTGTCTCTGAGCAAGGGAGCTGG + Intronic
1001210781 5:169808312-169808334 GTGTGTTTGGGGAATGGGACAGG + Intronic
1001269739 5:170302305-170302327 CTGTGTGTGGGGCTGGGGGAAGG + Intergenic
1001865510 5:175100884-175100906 ATGTGTGTGGGGTGGGGGGCGGG - Intergenic
1002300643 5:178255703-178255725 CTGTGACTGGGGACGGGGGAGGG - Intronic
1002514468 5:179746962-179746984 CTGTTTCAGGGGTAGGCGGCTGG - Intronic
1002738522 5:181416177-181416199 CTGAGTCTGGGGAAGGGAGCTGG - Intergenic
1002887657 6:1311216-1311238 CTGTGTCTGGCGCAGGGTGCTGG - Intergenic
1003555978 6:7140915-7140937 CTGTTTCTGGGGAGGGGCGAGGG + Intronic
1003637297 6:7844601-7844623 CTGCGGGTGGGGAAGGGGGGTGG - Intronic
1004606649 6:17201014-17201036 CTGTGTCTAGCTAATGGGGCGGG + Intergenic
1005507331 6:26481222-26481244 CAGTTTGTGTGGAAGGGGGCAGG - Intergenic
1005570875 6:27144453-27144475 CTCTGTCTGGGGGGGGGGGGGGG + Intergenic
1005899355 6:30204578-30204600 TTGTGTATGGGGAAGGGGAGCGG - Intronic
1005919744 6:30390161-30390183 CTGTGTGTGTGGTGGGGGGCGGG + Intergenic
1006104930 6:31710733-31710755 CTGTGTATGGGGAGGGGTGGGGG + Intronic
1006119852 6:31797353-31797375 CTATGTGTTGGGCAGGGGGCTGG - Intergenic
1006189084 6:32196672-32196694 CAGTGTCTGTGGAAAGGGGGGGG - Intronic
1006365783 6:33614373-33614395 CTGGGGCCGGGGAAGGGGACTGG - Intergenic
1006395088 6:33782051-33782073 CTGTGTTAGGGGAAGGCGACAGG - Intronic
1006417467 6:33913212-33913234 CTGTGCCTGGGTAGGGGAGCAGG - Intergenic
1006462886 6:34173761-34173783 CTGTGCCTGCGGAAAGGGGAGGG - Intergenic
1006832567 6:36977606-36977628 CAGTCTCGGGGGAAGGGGGGTGG + Intronic
1007255003 6:40522393-40522415 CTGTGCCTTGGGTAGTGGGCTGG - Intronic
1007378008 6:41469466-41469488 CTGTCTCTAGGAAAGGGGGTGGG + Intergenic
1008022852 6:46600526-46600548 CAGAGGCTGGGGAATGGGGCTGG - Intronic
1008046230 6:46854208-46854230 CTGGGTCTTGGGAGGAGGGCAGG - Intronic
1008595179 6:53035030-53035052 CTTTGGCTGGAGAAGTGGGCAGG + Intronic
1008605665 6:53137107-53137129 CTGTGGTTTGGGAAGGGGGAAGG + Intronic
1008989724 6:57588335-57588357 GTGACTGTGGGGAAGGGGGCAGG + Intronic
1009178307 6:60486879-60486901 GTGACTGTGGGGAAGGGGGCAGG + Intergenic
1009787912 6:68362278-68362300 GTGTGTCAGGGGATGGGGGCAGG + Intergenic
1010563297 6:77377519-77377541 TTGTGTCTGAGGAAGAGGCCTGG - Intergenic
1010980153 6:82363032-82363054 CTACATCTGGGGAGGGGGGCGGG + Intergenic
1011654823 6:89542505-89542527 CTGTGTCTCGGGAAGCGGGGGGG - Intronic
1011673114 6:89703356-89703378 CCATGTATGGGGAAGGGGGGGGG + Intronic
1011746888 6:90415066-90415088 TTCTGTGTAGGGAAGGGGGCTGG + Intergenic
1012098625 6:94999535-94999557 CTGTTTCTGGTGAAGGGCTCAGG - Intergenic
1012237899 6:96838606-96838628 CTCTGTCTGAGGAGGTGGGCAGG + Intergenic
1012541118 6:100363046-100363068 GTGTGTGTGGGGAGAGGGGCAGG - Intergenic
1012970902 6:105729276-105729298 GTGTGCCTGGGGATTGGGGCTGG + Intergenic
1013273673 6:108562887-108562909 CTGTCTTGGGGGAAGGGGCCAGG - Intronic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1013524131 6:110958882-110958904 CTGTGTGTGGGGAAGGGAGTTGG + Intronic
1013734056 6:113205353-113205375 GTGTGTGTGGTGAAGGGTGCAGG + Intergenic
1014421041 6:121245733-121245755 CTGAATCTGGGGATGGGGGGAGG - Intronic
1015456785 6:133435462-133435484 CTGTGTCTGGGGAAATGGGTTGG + Intronic
1015627488 6:135195731-135195753 CTGTGTCTAAGGAAGGGGGAAGG - Exonic
1015675765 6:135746497-135746519 GTGGGTCGGGGGAAGGGGGAGGG + Intergenic
1015685113 6:135850685-135850707 CTCTGTCGTGGGAATGGGGCTGG + Intergenic
1015778574 6:136839948-136839970 ATTTGTCTGGGGAAGGGGCAGGG + Intronic
1015902381 6:138081388-138081410 CGGGGTCAGGGGAAGGGGGGAGG + Intergenic
1016506860 6:144791680-144791702 CAGTGTCAGGGTAAAGGGGCAGG - Intronic
1017020259 6:150134261-150134283 CTGTGCCAGGGAACGGGGGCTGG - Intergenic
1017616765 6:156254295-156254317 CTGTGTCAGGGGCAGGCTGCAGG - Intergenic
1018383884 6:163285318-163285340 ATGTGTCAGGGGAAGCGGGAGGG - Intronic
1018468789 6:164078707-164078729 CTGTCTCAGGGGAAGGCTGCTGG + Intergenic
1018750341 6:166798765-166798787 CTGTCTGTGGAGAAGGGGGCAGG - Intronic
1018798289 6:167203780-167203802 CTGAGTCTGGGGAAGGAATCAGG - Intergenic
1018814423 6:167320396-167320418 CTGAGTCTGGGGAAGGAATCAGG + Intergenic
1019168956 6:170117807-170117829 CTTTCTCTGGAGAAGGGGTCAGG - Intergenic
1019221339 6:170475172-170475194 CTGTGACTGGTGCAGGGGGCCGG + Intergenic
1019243625 6:170691729-170691751 CTGAGTCTGGGGAAGGGAGCTGG - Intergenic
1019563172 7:1667779-1667801 CTGGGTCTGGGGGAGGGGCAGGG + Intergenic
1019631941 7:2054086-2054108 CTGTGTTGGGGGAGGTGGGCTGG - Intronic
1019701859 7:2477986-2478008 CTGTCCCTGGGGCTGGGGGCAGG - Intergenic
1019710755 7:2517165-2517187 CTGAGCCTGGGGAAGCGGGCGGG + Intronic
1019811340 7:3167374-3167396 CTGTGTGTGGGGATGGGGATGGG - Intronic
1019878615 7:3838650-3838672 CTGTGTTCAGGGACGGGGGCTGG - Intronic
1019911401 7:4102504-4102526 CTGCGTGTGGGGAAGGGAGGAGG - Intronic
1020096338 7:5371429-5371451 CTCTGTCTGGGGTGGTGGGCGGG - Intronic
1020115558 7:5474166-5474188 CTGGGGCTGAGGGAGGGGGCTGG + Intronic
1022023193 7:26421300-26421322 TCGTGTCTGGGGAAGGGGCCGGG - Intergenic
1022109130 7:27217285-27217307 GTGTGTGTGGGGAAGGTGGTGGG + Intergenic
1022109434 7:27219504-27219526 CTGAGTTGGGGGAAGGGGGGAGG + Intergenic
1022265510 7:28750198-28750220 CTGGTTCTGGGGCTGGGGGCTGG - Intronic
1022366916 7:29730435-29730457 CTCTGCCTGGGGAAAGGGGAAGG - Intergenic
1022474204 7:30699699-30699721 CCGTGCCTGGGTGAGGGGGCAGG - Intronic
1022517265 7:30983987-30984009 TGGGGTCTGGGGCAGGGGGCGGG - Intronic
1022801247 7:33779492-33779514 CAGTGTAGGGGGAAGGGGGAGGG + Intergenic
1022889371 7:34681156-34681178 CTTGGTCTGGGGATGGAGGCAGG - Intronic
1023109010 7:36791543-36791565 GTGTGGCTTGGGAAGGAGGCAGG + Intergenic
1023109746 7:36797248-36797270 GTGTGCTTGGTGAAGGGGGCAGG - Intergenic
1023522815 7:41065845-41065867 CTGTGGGTGGGGAAGGCGGGAGG + Intergenic
1023658302 7:42448379-42448401 GTGTGTCTGGGGAGGTGGGCTGG + Intergenic
1023666498 7:42527965-42527987 ACATGTCTGTGGAAGGGGGCTGG - Intergenic
1023843370 7:44108588-44108610 CTGTGCCTGGGGTTGCGGGCTGG - Intronic
1023883536 7:44335090-44335112 CAGGGACTGGGAAAGGGGGCAGG - Intergenic
1026877466 7:73887693-73887715 CTCAGTCTGGGGTAGGGGTCAGG + Intergenic
1027188528 7:75985398-75985420 CTGGTTCTGGGGACCGGGGCTGG - Intronic
1027699810 7:81455991-81456013 GTGTGTGTGGGGGAGGGGGTGGG + Intergenic
1027744598 7:82057441-82057463 ATGTGTTGGGGGAAAGGGGCAGG + Intronic
1027867140 7:83662584-83662606 TAGTTTCTGGGGAAGGAGGCTGG + Intergenic
1027996168 7:85427517-85427539 CTCTGTCTGTGGAAAGGGGAAGG + Intergenic
1028561486 7:92180391-92180413 CTGGGTGTGGAAAAGGGGGCTGG - Intergenic
1028899242 7:96077267-96077289 GTGTGTGTGTGGGAGGGGGCAGG + Intronic
1029496474 7:100897544-100897566 CTGTGCATGGGGGAGGGGACAGG + Intergenic
1029825348 7:103187020-103187042 CTCTGCCTGGGGAAAGGGGAAGG + Intergenic
1030061070 7:105621762-105621784 CTGTGTCTGGGAGAGAGGCCAGG - Intronic
1030438245 7:109552428-109552450 GAGTGCCTGGGGAATGGGGCAGG + Intergenic
1031143311 7:117969549-117969571 GTGGGGTTGGGGAAGGGGGCAGG + Intergenic
1031174332 7:118330411-118330433 CTGTCTCTGGTGAAGGGGCAGGG + Intergenic
1031982444 7:128136422-128136444 CTGTGTCTGAGCAAGGAGGGTGG - Intergenic
1032398611 7:131608326-131608348 CTCTGTCTGTTGAAGGGGGATGG + Intergenic
1032582554 7:133116863-133116885 GTGTGTGTGGGGAGGGGGGGCGG - Intergenic
1033840669 7:145369960-145369982 TTGTGGGTGGGGAAGGGGTCTGG + Intergenic
1033925981 7:146460806-146460828 CAGTGTCTGGGGTATAGGGCAGG + Intronic
1034285478 7:149880778-149880800 GTGGGTCTGGGGAGGGGAGCAGG + Intergenic
1034396505 7:150829689-150829711 GTGAGTCTGGGGAAAGGGGGAGG - Intronic
1034412802 7:150950149-150950171 CTGGGTATGGGGTGGGGGGCGGG - Exonic
1034581923 7:152050938-152050960 CTGTGTTTGGGGGAGGGAGAGGG - Intronic
1035204684 7:157287502-157287524 GTCTGTCTGGGGAAAGGGTCAGG - Intergenic
1035243319 7:157546425-157546447 CTGTCAGTGGGGAAGGGGGATGG - Intronic
1035414432 7:158671072-158671094 CTCTGTGTGGGGCAGGGGGGTGG + Intronic
1035414455 7:158671154-158671176 CTCTGTGTGGGGCAGGGGGGTGG + Intronic
1035447196 7:158951316-158951338 CTGTGCCTGATGATGGGGGCAGG - Intronic
1035504497 8:116431-116453 CTGAGTCTGGGGAAGGGAGCTGG + Intergenic
1035601320 8:898543-898565 CTGTGTGCAGGGAAGGGGCCTGG + Intergenic
1035613029 8:981077-981099 CAGGGTCTGGGGCAGGGGACAGG - Intergenic
1036050704 8:5192994-5193016 CTGTTTGTGGGGTAGGGGGACGG + Intergenic
1036699238 8:11000976-11000998 CTGAATCAGAGGAAGGGGGCAGG - Intronic
1036760108 8:11502858-11502880 CGGTGGCAGGGGAAGGGGGGTGG + Intronic
1036959369 8:13227029-13227051 CTGTGTATGGTATAGGGGGCGGG + Intronic
1037002948 8:13743129-13743151 GTGTGTGTGGGGAGGGGGGCTGG + Intergenic
1037544116 8:19900840-19900862 CTGTTTGTGGGGAAGGGTGGAGG + Intergenic
1039434009 8:37547271-37547293 GTGTGTATGGGGTGGGGGGCGGG - Intergenic
1040552703 8:48450748-48450770 CTGTGTCTGGATGAGGGGGAAGG + Intergenic
1040697460 8:50019047-50019069 CTGGGTCTGGGGAAGGGTCAAGG + Intronic
1041406226 8:57502184-57502206 CTGTGTGTGGGGTTGGGGGCAGG + Intergenic
1041631720 8:60096304-60096326 AAGTTTCTGGGGCAGGGGGCTGG - Intergenic
1042140748 8:65676142-65676164 GTGTGTGTTGGGAAGGGGGAAGG - Intronic
1042670262 8:71254841-71254863 CTGTGTGTGTGGTGGGGGGCGGG - Intronic
1044499772 8:92939910-92939932 CTGTGGTTGGGCAAGGGTGCAGG - Intronic
1044727932 8:95208176-95208198 GTGTGTGTGGGGGAGGGGGGGGG + Intergenic
1045041258 8:98227001-98227023 CTCTGCCTGGGGAAAGGGGAGGG - Intronic
1045412432 8:101932190-101932212 CTGTGGCAGGGGAGGGGGCCTGG - Intronic
1045516226 8:102863420-102863442 CTGTTTCCGGGGAGGGGGCCCGG - Intronic
1046644957 8:116776082-116776104 CAGGGTATGGGGAAGGGGCCAGG - Intronic
1047117398 8:121859254-121859276 ATGTGTCTCGGGATGGGGGCTGG - Intergenic
1047663908 8:127068708-127068730 CTCTTTCTGGGGAAAAGGGCAGG + Intergenic
1047694607 8:127391098-127391120 GTGTGTCAGGGGAAAGGGACCGG + Intergenic
1047885297 8:129243678-129243700 GTGTGTGTGGGGGCGGGGGCAGG + Intergenic
1047980964 8:130181659-130181681 CTGTGTGTGGGGAGGGGGCCAGG + Intronic
1048063501 8:130944878-130944900 CTGAGTCTGAGGAATGGAGCTGG + Intronic
1048064143 8:130950477-130950499 CTGTGTCAGGGTTTGGGGGCTGG + Intronic
1048298502 8:133234294-133234316 GTATGTGGGGGGAAGGGGGCAGG + Intergenic
1048574419 8:135679649-135679671 GTGTGTCTGGGGTAGAGCGCAGG + Intergenic
1048765274 8:137836820-137836842 CTGTGTTGGGGGAAGGGAGAGGG - Intergenic
1048832134 8:138487627-138487649 GTGTGTGTGGGGGTGGGGGCGGG + Intronic
1049346940 8:142144136-142144158 CTGTGGCCAGGGAAGGGGGTGGG + Intergenic
1049426756 8:142541192-142541214 CTCTGTCAGGGGCAGGCGGCTGG + Intronic
1051585930 9:18726889-18726911 CTGGGGCTGGGGCAGGGGGAGGG - Intronic
1051594989 9:18816142-18816164 CAGAGACTGGGGAAGGGAGCGGG - Intronic
1051629556 9:19128899-19128921 CTGTGTCGGGGGCCGGGGGGGGG - Intronic
1052552652 9:29970312-29970334 CTGTGTCTTGGAAAGGGTGGGGG + Intergenic
1053409668 9:37907392-37907414 CTGGGGCAGGGGAATGGGGCCGG - Intronic
1053435177 9:38069329-38069351 CTGGGTCTGCGGGAGCGGGCGGG - Intergenic
1055799803 9:80022679-80022701 CTTTCTCTGGGGTATGGGGCAGG - Intergenic
1056420928 9:86425481-86425503 GTGTGTATGCGGAATGGGGCAGG - Intergenic
1056797269 9:89667068-89667090 CTGTGTCTGGGGATCTGGTCTGG + Intergenic
1056832717 9:89929803-89929825 CGGGGGCTGGGGAAGGGAGCAGG + Intergenic
1056832725 9:89929822-89929844 CAGGGGCTGGGGAAGGGAGCAGG + Intergenic
1057147042 9:92765195-92765217 CTGAGTGTGGGGAAGGCCGCGGG - Intergenic
1057284853 9:93743758-93743780 GTGGATCTGGGGAAGGGGCCAGG - Intergenic
1057310672 9:93941037-93941059 CTGTGTCTGGGGGTGGGAGGAGG - Intergenic
1057314807 9:93961300-93961322 CTGGGATTGGGGAAGGGGTCTGG + Intergenic
1057316105 9:93969382-93969404 CTGGGGCTGGGGGAGGAGGCTGG + Intergenic
1057410189 9:94811018-94811040 ATGTGACAGGGGTAGGGGGCAGG - Intronic
1058437300 9:104974864-104974886 CTATGTCGGGGGCTGGGGGCGGG + Intergenic
1058684154 9:107465918-107465940 CTGGGACTGGGTAAGGGCGCGGG + Intergenic
1059115867 9:111599619-111599641 CACTGCCTGGGGAAGGCGGCTGG + Exonic
1059455010 9:114394918-114394940 CTTTTTCTGGGGAAGGAGCCTGG - Intergenic
1059699406 9:116760655-116760677 TTGTGCCTGGGGAAGGGGGAGGG + Intronic
1059921528 9:119165917-119165939 CTGTGTGTGGGGAACGGGAGTGG + Intronic
1059960727 9:119561783-119561805 CGGGGTGTGGGGAAGGGGGAGGG + Intergenic
1059965130 9:119606254-119606276 ATGTGTCAGGGGTGGGGGGCTGG - Intergenic
1060188316 9:121577183-121577205 CTGTGTCCAGGGGAAGGGGCAGG - Intronic
1060206021 9:121683320-121683342 TTGGGGCTGGGGAAGGGAGCAGG - Intronic
1060396624 9:123321050-123321072 CAGTGCCTGAGGAAGGGGCCTGG - Intergenic
1060405030 9:123368832-123368854 CTGAGGCTGGGGAAGTGGGGAGG - Intronic
1060594419 9:124839865-124839887 CTGTGTCTGGGGGTAGGGGTGGG - Intergenic
1060790672 9:126483529-126483551 CTGTGTCTGGGTAAGGCAGGAGG - Intronic
1060828733 9:126700837-126700859 ATGTGTCTGGGGATGGCGGGTGG - Exonic
1060886688 9:127159499-127159521 CTCGGTCTGCAGAAGGGGGCAGG - Intronic
1061127041 9:128683720-128683742 ATGAGGCTGGGGGAGGGGGCCGG + Exonic
1061202214 9:129144383-129144405 CGCTGTGTGGGGAAGGGGACAGG + Intronic
1061471630 9:130831339-130831361 GTGTGTCAAGGGAAGGAGGCAGG - Intronic
1061540952 9:131277631-131277653 CAGTGCCCGGGGAAGGGGGTGGG - Intergenic
1061550356 9:131331101-131331123 ATGTGGCTGGTGAAGGTGGCTGG - Intergenic
1061667480 9:132168969-132168991 CTCTGTCTGAGGGTGGGGGCAGG - Intronic
1061803704 9:133126917-133126939 CGGTGTCTGGGTATGGGAGCAGG - Intronic
1061864507 9:133485422-133485444 CCGTGTCTTGGGAAGGTGGGAGG + Intergenic
1062306061 9:135907636-135907658 CTGCGCCTGCGGAAAGGGGCGGG - Intergenic
1062306078 9:135907687-135907709 CTGCGCCTGCGGAAAGGGGCGGG - Intergenic
1062306093 9:135907738-135907760 CTGCGCCTGCGGAAAGGGGCGGG - Intergenic
1062306106 9:135907781-135907803 CTGCGCCTGCGGAAGCGGGCGGG - Intergenic
1062391466 9:136335654-136335676 CTGGGCCTGGGGCAGGGGGCTGG - Intronic
1062629223 9:137456200-137456222 GTGTGTGTGGGGGGGGGGGCTGG + Intronic
1062675460 9:137740526-137740548 CTGTGTCCAGGGAAGGGGTCTGG - Intronic
1062712433 9:137983887-137983909 GTGTGTCTGGGGTGGGGGGTGGG + Intronic
1203518585 Un_GL000213v1:26086-26108 CGGTGTCCGGGGAAGGGGGCGGG + Intergenic
1203455228 Un_GL000219v1:160822-160844 GTGGGTTGGGGGAAGGGGGCAGG - Intergenic
1203603814 Un_KI270748v1:40952-40974 CTGAGTCTGGGGAAGGGAGCTGG - Intergenic
1186038451 X:5449565-5449587 CTGTGTGTGGGGAGGGAGGTGGG - Intergenic
1186389820 X:9147937-9147959 CTGTGGCTGGGGGTGGGGGAGGG - Intronic
1186612313 X:11149457-11149479 GTGTGTTGGGGGAGGGGGGCAGG + Intronic
1188776337 X:34224182-34224204 CTGTGTTTGGGGAATAGGGGTGG - Intergenic
1189286268 X:39854456-39854478 CTGGGGCCGGGGAAGGAGGCTGG - Intergenic
1189851353 X:45179173-45179195 CTTTGTTGGGGGAAGGAGGCTGG - Intronic
1190970434 X:55342707-55342729 CTGTGTGTTGGGACGGGGGTAGG - Intergenic
1192185504 X:68944265-68944287 CTGTGTGTGGGGATGAGTGCAGG + Intergenic
1192240460 X:69323985-69324007 CTGTCTCTGGGGACGGAGGATGG + Intergenic
1192265153 X:69532562-69532584 CTGTGGCTTGGGGAGGGGGTGGG + Intergenic
1192269445 X:69565004-69565026 TTGTGGCTGGAGTAGGGGGCAGG + Intergenic
1192798476 X:74444001-74444023 GTGTGTCTGGGGGCAGGGGCAGG + Intronic
1194024534 X:88735640-88735662 CTGTGTCTGGGGAGGGTGGGTGG + Intergenic
1195239406 X:102936195-102936217 GTGTGTCTGTGTATGGGGGCAGG - Intergenic
1195270176 X:103221030-103221052 TGGTGGTTGGGGAAGGGGGCGGG - Intergenic
1195298301 X:103501866-103501888 GTGTGTCTGTGTATGGGGGCAGG + Exonic
1195397242 X:104424919-104424941 CAGGGTTTGGGAAAGGGGGCTGG - Intergenic
1195690449 X:107620020-107620042 CTCTGTCTGGGCAGTGGGGCGGG - Intergenic
1195881260 X:109594885-109594907 GTGTGTCTGTGGTAGGAGGCAGG - Intergenic
1195992115 X:110693149-110693171 GTGTGTGTGGGGGTGGGGGCAGG + Intronic
1196031183 X:111096763-111096785 CTGGGGCTGGGTAGGGGGGCGGG - Intronic
1196776273 X:119340786-119340808 CAGTGTCTGGGCAGGTGGGCGGG + Intergenic
1197053967 X:122094533-122094555 CTCTGCCTGGGGAAAGGGGAAGG + Intergenic
1197346317 X:125327926-125327948 CTGTGGTTGAGGAAGGGGGCAGG - Intergenic
1197543521 X:127794741-127794763 CTGGGTTTGGGGGAGGGGGGAGG + Intergenic
1197572105 X:128162862-128162884 CTGTCTCTGGTGAAAGTGGCAGG + Intergenic
1197773813 X:130107354-130107376 CTGTGTGTGGGGAGGGTGGGAGG + Intronic
1197883476 X:131193343-131193365 CTGTGTCAGGGGAACAGAGCTGG - Intergenic
1198279415 X:135126907-135126929 GTCTGTCAGGGGAAGGGGACAGG + Intergenic
1198291541 X:135245607-135245629 GTCTGTCAGGGGAAGGGGACAGG - Intergenic
1198531365 X:137551683-137551705 GTGTGTTTGGGGCAGGGGGTGGG + Intergenic
1198574773 X:137998136-137998158 CTGGGTTTGGGGCAGGGGGCTGG - Intergenic
1198607401 X:138356560-138356582 ACCTGTCTGGGGAAGGTGGCAGG + Intergenic
1198869532 X:141161190-141161212 CTCTGTCTGGGGGCGGGGGTGGG + Intergenic
1199767516 X:150952123-150952145 CTAGGTCTAGGGCAGGGGGCAGG + Intergenic
1199878542 X:151954566-151954588 TTCTGTTTGGGGAATGGGGCAGG + Exonic
1199896286 X:152130682-152130704 CACTGTCTGGGGTAGAGGGCTGG - Intergenic
1199951107 X:152706771-152706793 CAGTGTCTGGGGTAGGGGGCTGG + Intergenic
1199953750 X:152725984-152726006 CAGTGCCTGGGGTAGAGGGCTGG + Intergenic
1199958577 X:152761690-152761712 CAGTGTCTGGGGTAGGGGGCTGG - Intergenic
1199965731 X:152819103-152819125 GTGTGTTTGGGGGTGGGGGCTGG - Intergenic
1200012920 X:153133670-153133692 CTGTGTCGGGGGCGGGGGGGAGG - Intergenic
1200026681 X:153266253-153266275 CTGTGTCGGGGGCGGGGGGGAGG + Intergenic
1200081810 X:153580696-153580718 CTGTGTGGTGGGCAGGGGGCTGG + Exonic
1200144255 X:153918312-153918334 CTGTTTCTGGGGGTGGGAGCTGG + Intronic
1200254939 X:154575585-154575607 CTGTGTCCTGGGGAGGGGTCAGG + Intergenic
1200262830 X:154628823-154628845 CTGTGTCCTGGGGAGGGGTCAGG - Intergenic
1200315933 X:155132999-155133021 CTCTGCCTGTGGAAGGGGGAGGG + Intronic
1201403017 Y:13623505-13623527 GTGTGGCTGGGGAAGGGGGGAGG - Intergenic
1201428176 Y:13877112-13877134 CTGTGTCAAGGAAAGGGGGAAGG + Intergenic
1201633035 Y:16091256-16091278 CTGTGTGTGGGGAGGGAGGTGGG + Intergenic
1202385875 Y:24325997-24326019 CTGAGTCTGGGGAAGGGAGCTGG - Intergenic
1202484911 Y:25344131-25344153 CTGAGTCTGGGGAAGGGAGCTGG + Intergenic