ID: 985710168

View in Genome Browser
Species Human (GRCh38)
Location 5:1423393-1423415
Sequence AGGGTCCCTCTCCAGGGATG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 263
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 240}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985710157_985710168 3 Left 985710157 5:1423367-1423389 CCCACTGCTGCCCACAAGACAGC 0: 1
1: 0
2: 0
3: 34
4: 423
Right 985710168 5:1423393-1423415 AGGGTCCCTCTCCAGGGATGAGG 0: 1
1: 0
2: 0
3: 22
4: 240
985710155_985710168 19 Left 985710155 5:1423351-1423373 CCCACGCTGCTGGGTACCCACTG 0: 4
1: 3
2: 10
3: 14
4: 118
Right 985710168 5:1423393-1423415 AGGGTCCCTCTCCAGGGATGAGG 0: 1
1: 0
2: 0
3: 22
4: 240
985710161_985710168 -7 Left 985710161 5:1423377-1423399 CCCACAAGACAGCCCCAGGGTCC 0: 1
1: 0
2: 3
3: 15
4: 253
Right 985710168 5:1423393-1423415 AGGGTCCCTCTCCAGGGATGAGG 0: 1
1: 0
2: 0
3: 22
4: 240
985710156_985710168 18 Left 985710156 5:1423352-1423374 CCACGCTGCTGGGTACCCACTGC 0: 4
1: 3
2: 7
3: 14
4: 142
Right 985710168 5:1423393-1423415 AGGGTCCCTCTCCAGGGATGAGG 0: 1
1: 0
2: 0
3: 22
4: 240
985710152_985710168 30 Left 985710152 5:1423340-1423362 CCACAGTGCTGCCCACGCTGCTG 0: 10
1: 4
2: 9
3: 62
4: 451
Right 985710168 5:1423393-1423415 AGGGTCCCTCTCCAGGGATGAGG 0: 1
1: 0
2: 0
3: 22
4: 240
985710162_985710168 -8 Left 985710162 5:1423378-1423400 CCACAAGACAGCCCCAGGGTCCC 0: 1
1: 0
2: 0
3: 30
4: 335
Right 985710168 5:1423393-1423415 AGGGTCCCTCTCCAGGGATGAGG 0: 1
1: 0
2: 0
3: 22
4: 240
985710158_985710168 2 Left 985710158 5:1423368-1423390 CCACTGCTGCCCACAAGACAGCC 0: 1
1: 0
2: 3
3: 44
4: 337
Right 985710168 5:1423393-1423415 AGGGTCCCTCTCCAGGGATGAGG 0: 1
1: 0
2: 0
3: 22
4: 240

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985710168 Original CRISPR AGGGTCCCTCTCCAGGGATG AGG Intronic
900010563 1:103441-103463 AGGGTCTCTTTCCAGGGTTAAGG + Intergenic
900036461 1:413911-413933 AGGGTCTCTTTCCAGGGTTAAGG + Intergenic
900058090 1:649665-649687 AGGGTCTCTTTCCAGGGTTAAGG + Intergenic
900096853 1:943260-943282 AGGGGGACTCTCCATGGATGGGG + Exonic
900657844 1:3768798-3768820 GGGGTCCCTCCCCAGGGTAGAGG - Intronic
900756145 1:4436345-4436367 AGGCTCCCTCCCCATGGCTGTGG + Intergenic
901436804 1:9251515-9251537 AGGGTCCCTGTCCTGACATGGGG + Intronic
901794592 1:11673049-11673071 AGGGTCCCTCTTCTCAGATGGGG + Intronic
902639195 1:17755851-17755873 AGGGTCCCTTCCCTGGGGTGAGG + Intronic
902989807 1:20178937-20178959 AGGCCCCCTCTTCAGGGCTGGGG + Intergenic
903216447 1:21846096-21846118 AGGGACCCTCACCGGGGACGTGG + Exonic
903378714 1:22882526-22882548 AGGGCCCCTCTCCCAGGCTGAGG + Intronic
903659048 1:24965790-24965812 GGGGGCCCTCTGCAGGGCTGGGG + Intergenic
904541832 1:31238831-31238853 GGTGACCCTCTCCAGGGAGGTGG + Intronic
904746882 1:32716796-32716818 AGGGCCTCTCTCCAGAGCTGGGG - Intergenic
904998162 1:34647499-34647521 AGGGGCCCTGCCCAGGGATGGGG - Intergenic
906069298 1:43006039-43006061 GGGCTCCCTTTCCAGGAATGGGG + Intergenic
906637244 1:47417435-47417457 TGGGAGCCTCCCCAGGGATGGGG - Exonic
906899391 1:49817041-49817063 GGGCTGCCTCTTCAGGGATGTGG - Intronic
907385008 1:54120631-54120653 AAGGTCCCTCTGCTGGGGTGTGG + Intergenic
907495527 1:54841721-54841743 TGGGTGTCCCTCCAGGGATGAGG + Intronic
910802646 1:91161148-91161170 AGAATCTCTCTCCTGGGATGTGG + Intergenic
914230360 1:145760445-145760467 AGGGTCCCTCTCACAGCATGTGG - Intronic
922135790 1:222825124-222825146 ATAGTCTCTCCCCAGGGATGGGG + Intergenic
922235839 1:223721840-223721862 AGGATCCCTTCCCAGGGCTGTGG + Intronic
922259002 1:223919448-223919470 AGGGTCTCTTTCCAGGGTTAAGG + Intergenic
922462451 1:225823950-225823972 GGGCTCCCTCGCCAGGGCTGCGG - Intronic
922722447 1:227905824-227905846 AGGGCCCTTCCCCAGGGAAGCGG - Intergenic
1063037266 10:2298741-2298763 AGTGTCTCTCTCCAGGGCAGAGG + Intergenic
1063775484 10:9259021-9259043 AGATTCTCTCTTCAGGGATGTGG - Intergenic
1063949829 10:11212191-11212213 AGGGGCCTGCTGCAGGGATGTGG - Intronic
1066452920 10:35547827-35547849 AGGCTTCCTATCCAGGGAAGAGG + Intronic
1067041268 10:42954440-42954462 AGGTGCCCTCTCCTGGGAGGTGG - Intergenic
1067078529 10:43201507-43201529 AGGCTCCCACTCCAGGGACAAGG + Intronic
1067494344 10:46748451-46748473 TGGGTTCCTCTCCATGGAAGAGG + Intergenic
1067600315 10:47591946-47591968 TGGGTTCCTCTCCATGGAAGAGG - Intergenic
1068237755 10:54261834-54261856 TGGGTTCCTCTCCATGGAAGAGG - Intronic
1068710345 10:60126954-60126976 ATACTCCCTTTCCAGGGATGGGG + Intronic
1068856427 10:61802535-61802557 AGTGTCCTTCTCCAGGGCCGAGG - Intergenic
1069675671 10:70245486-70245508 AGGATCCGTGTCCAGGGCTGGGG - Intergenic
1069778274 10:70939338-70939360 AGGGTCCCTCACTCGGGCTGAGG - Intergenic
1071448948 10:85776500-85776522 AGGTCACCTCTCCAGGGAAGTGG + Intronic
1072483195 10:95829280-95829302 AGGGACCCTCTCAAGAGCTGTGG + Intronic
1073107209 10:101039084-101039106 AGGGCCTATCTCCAAGGATGGGG + Intronic
1074624503 10:115165601-115165623 AGGGGACCTCTCCAGAGATATGG + Exonic
1074878726 10:117634737-117634759 AGGGTCCCACACCATGGGTGAGG + Intergenic
1074879667 10:117645886-117645908 AGTGTCCCTCTCCACAGATCTGG + Intergenic
1075271882 10:121059498-121059520 AGGGAGACTCTGCAGGGATGGGG + Intergenic
1076515230 10:131041946-131041968 AGGATCACTCTCAAGAGATGGGG + Intergenic
1078935044 11:15942447-15942469 GGAGTCCCTCACCAGGGGTGAGG - Intergenic
1079181033 11:18193726-18193748 AGGGCACCTCTCTAGGGATTAGG - Intronic
1079277969 11:19059315-19059337 AGGGTACCGCTTTAGGGATGGGG + Intronic
1083431118 11:62613903-62613925 AGGGAGCCTGTCCAGGGAGGAGG - Intronic
1083593602 11:63908811-63908833 AGGGTGGCTCTCCTGGGGTGGGG + Intronic
1083641537 11:64148313-64148335 TGGGTCCAGCTGCAGGGATGTGG - Intronic
1083737601 11:64690548-64690570 AAGGGCCCTCTCCAGGGTGGAGG + Intronic
1083898239 11:65631037-65631059 AGGGCCCCTCTCAAAGGGTGGGG - Intronic
1084586985 11:70068061-70068083 AGGGCTCCTGTCCAGGGAGGAGG - Intergenic
1084926746 11:72519744-72519766 TGGGTCCTGCACCAGGGATGAGG - Intergenic
1085389864 11:76176835-76176857 AGGGGCCCCCTCCTGGGTTGGGG - Intergenic
1085415910 11:76318847-76318869 GGGCCCCATCTCCAGGGATGAGG - Intergenic
1089445110 11:118545745-118545767 AGTGTCTCTATCCAGAGATGGGG + Intronic
1091302097 11:134514402-134514424 AGGCTGACTCTCCAGGGAGGCGG + Intergenic
1091703149 12:2677318-2677340 AGGTTCCCTCTGCAGGGACCTGG - Intronic
1091770329 12:3147258-3147280 ACGGTCCCTGCCCTGGGATGAGG + Intronic
1092103597 12:5905055-5905077 GTCCTCCCTCTCCAGGGATGAGG - Intronic
1092195580 12:6547972-6547994 AGGGTCCTGCAGCAGGGATGAGG + Intronic
1092815172 12:12306323-12306345 AGGGTCCACCTCTGGGGATGGGG + Intergenic
1095990284 12:48029697-48029719 TGGGCCCCTCTCCAGGGAAGGGG + Intergenic
1096551984 12:52378953-52378975 AGTGTACCCCTCCATGGATGGGG - Intronic
1097454590 12:59781959-59781981 AGTGGCCTTCTCCAGGGAGGAGG + Exonic
1097976334 12:65690820-65690842 AGGGTTCTTCACCAGGGATTTGG - Intergenic
1100077335 12:90801855-90801877 AGGATCCTTCTCTAGGGAAGTGG - Intergenic
1101232146 12:102752378-102752400 AAGGACTCTCTCCCGGGATGGGG + Intergenic
1101417676 12:104522580-104522602 AGGGCCCATCTCCAGAGATTCGG - Intronic
1101834944 12:108288569-108288591 TGGGTCCTTCTCCAGAGAAGAGG - Exonic
1101877947 12:108607884-108607906 AGGGTCCCTCTGCAGGGACCTGG - Intergenic
1101923218 12:108949925-108949947 ATGGTCCCACTTCAAGGATGAGG - Intronic
1102032968 12:109753551-109753573 AGGCTCCCCCCCCCGGGATGGGG - Intronic
1103996667 12:124834422-124834444 AGCCTCCCACTCCAGGCATGAGG + Intronic
1104000124 12:124854964-124854986 AGGAGCCCACCCCAGGGATGAGG + Intronic
1104164000 12:126208318-126208340 TGGGTCCCTCTCCAGGTATAGGG - Intergenic
1104353784 12:128067534-128067556 ATGGTTCCTCTCCACTGATGAGG - Intergenic
1104553687 12:129780477-129780499 AAGGTCGCTATCCAGGAATGAGG - Intronic
1104679528 12:130739858-130739880 GGGGCCCCTCTGCGGGGATGGGG - Intergenic
1105296265 13:19090065-19090087 AGGGACCCTCTGCAGGGAGGTGG - Intergenic
1112197156 13:97237250-97237272 AGGGTCCCTCACCATGCATAAGG - Intronic
1112884112 13:104147659-104147681 AGGGAAACTCTGCAGGGATGGGG - Intergenic
1113735988 13:112679468-112679490 CGGGTCCATCTTCAGGGAAGAGG - Exonic
1116057396 14:39880713-39880735 AAGCTCCCTCTTCAGGCATGAGG - Intergenic
1121649013 14:95543152-95543174 AAGGTCCCTGTCCAGGGCTGAGG - Intronic
1122292619 14:100687761-100687783 TGGGACCCTCTCCAGGCCTGGGG + Intergenic
1122980815 14:105191706-105191728 AGGGTCCCCGTCATGGGATGGGG + Intergenic
1125356924 15:38826057-38826079 AGGGTCTCTCTCCTTGGTTGTGG + Intergenic
1125503348 15:40252835-40252857 GAGGTCCCGCTCCAGGGACGCGG - Exonic
1126455892 15:48861634-48861656 AGGGTGCCTTTTCAGGGATATGG + Intronic
1127506138 15:59599673-59599695 ATGGTGCCTCTCAAGGGCTGGGG + Intronic
1128393381 15:67198466-67198488 AGGGCCCCACTCCAGAGTTGCGG - Intergenic
1129792199 15:78348842-78348864 AGGGTCACCCTCCCAGGATGTGG + Intergenic
1132315851 15:100889894-100889916 AGGGGCGCTCTCCTGTGATGTGG - Intronic
1134556061 16:15166308-15166330 AGGGTCCCACTGCAGAGAAGGGG - Intergenic
1134916645 16:18078043-18078065 AGGGTCCCACTGCAGAGAAGGGG - Intergenic
1138506178 16:57479398-57479420 AGGGGCCCTGCCAAGGGATGGGG - Intronic
1139182210 16:64761693-64761715 GGGCTCCCTATCCAGGAATGAGG + Intergenic
1141414886 16:83863067-83863089 AGGGTCCCTCCCACGGCATGTGG - Intergenic
1141693047 16:85607202-85607224 TGGGTGCCTCTCCAGAGGTGGGG + Intergenic
1142010638 16:87712024-87712046 AGGGTCCCTGTGCAGGGCGGAGG - Intronic
1142952880 17:3497980-3498002 AGGGTCCCGCACCAGGGATTTGG - Intronic
1143067501 17:4261991-4262013 AGTTTCCCCCTCCAGGGATATGG + Intronic
1143128929 17:4663830-4663852 AGGCTCCCTCTCCAGCGGGGTGG - Intergenic
1145907350 17:28523854-28523876 AGGGTCCCAGCCCAAGGATGGGG + Intronic
1147263797 17:39223535-39223557 AGGGTCCCTGGCCTGGGAAGAGG + Intronic
1147850519 17:43439100-43439122 ATGGTCCACCCCCAGGGATGGGG + Intergenic
1148461793 17:47843371-47843393 TGGGTTCCTCTCCTGGGAAGTGG - Intergenic
1148577713 17:48723196-48723218 ACAGTCGCTCTCCAGGGAAGAGG - Intronic
1152077094 17:78166527-78166549 GGGGTGCCTCTCCAGGGAAGAGG - Intergenic
1152229392 17:79106906-79106928 AGGATCCCAGCCCAGGGATGGGG - Intronic
1152438837 17:80292797-80292819 AGGGTCACTGTGCAGGGAGGGGG - Intronic
1153837454 18:8976747-8976769 AGCATCCCTCTCCAGGGGTCAGG + Intergenic
1155521066 18:26669613-26669635 AGTGACCCTCTCTAGGGCTGAGG - Intergenic
1157138730 18:45084443-45084465 AGCGTCCCTTTCCTGGAATGGGG - Intergenic
1157300127 18:46473224-46473246 TGGGTGGGTCTCCAGGGATGTGG - Intergenic
1157468336 18:47967687-47967709 AGGGTCCCTTTCCATGCATATGG - Intergenic
1158632194 18:59125279-59125301 ACGGTCCCTCAGCACGGATGTGG - Intergenic
1161343242 19:3753987-3754009 AGGGACCCGCCCCAGGGATGCGG - Intronic
1162362411 19:10227912-10227934 AAGGTCCCTTTCCAGGCCTGGGG + Intronic
1162901473 19:13797348-13797370 GGGGCCCCTTCCCAGGGATGGGG + Intronic
1163746421 19:19051518-19051540 AGGTTCCCTCCCCTGGGATCTGG - Intronic
1163762486 19:19145323-19145345 ATGGTCCCACTCCAGGGGTGAGG - Intergenic
1163866659 19:19778732-19778754 ATGGTCCCTTTCCAGGGATCTGG - Intergenic
1164627821 19:29741127-29741149 AGGGACCCTCACCATGGATGTGG - Intergenic
1164729435 19:30491424-30491446 AGAGTCCCTCTCCAGTTATCAGG + Intronic
1165707314 19:37985833-37985855 AGGGCCCTTACCCAGGGATGCGG + Intronic
1166013539 19:39961778-39961800 AGGGACCCTCTGAAGGGATCAGG - Intergenic
1166252470 19:41580842-41580864 CAGGTCCCTCCCCAGGGATTAGG + Intronic
1167262163 19:48464839-48464861 TGGGGCTCTCTCCTGGGATGGGG + Exonic
1167705013 19:51076823-51076845 AAGGTCACTCTGCAGGGCTGAGG + Intergenic
1168575370 19:57504539-57504561 AGGGTCTCTCTTCTGAGATGGGG + Intronic
925238416 2:2299204-2299226 TGGGTTCCTCTCCAGGGACTTGG + Intronic
925994027 2:9277123-9277145 ATGGCCCCTCTCCTGGGATGGGG + Intronic
926050427 2:9740917-9740939 AGGCTCCCCTTCCAGGGCTGAGG - Intergenic
926052510 2:9753930-9753952 TGGGATCCTCTCCAGGGATGAGG + Intergenic
926148551 2:10411761-10411783 AGGATCTTTCTCCAGGGAAGTGG - Intronic
926784909 2:16509232-16509254 GGGCTCCCTCTCCTGGGCTGGGG + Intergenic
927676135 2:25107487-25107509 AGGTCTCCTCTCCAGAGATGCGG - Intronic
927936830 2:27080833-27080855 AGAGTCCCGCTCCAGCGCTGGGG + Exonic
927948954 2:27154655-27154677 AGGGTCCCTCTGCAGAGACGTGG - Exonic
930640936 2:53853975-53853997 GGGGTCCCTGTGCAGGGAGGTGG - Exonic
932573567 2:72950862-72950884 AGGGGCCTTCTCCGGGGATAAGG + Intronic
933760936 2:85671535-85671557 GGCTTCCCTTTCCAGGGATGTGG - Intergenic
935321960 2:101897882-101897904 TGTGTCCCTCTCCTGCGATGAGG - Intergenic
935714987 2:105931900-105931922 AGTCTCCCTCCCCAGAGATGAGG - Intergenic
936076015 2:109402340-109402362 GGGCTCCCTCTCCTGGGCTGTGG - Intronic
936513698 2:113168402-113168424 AGGGCCCCTCTCCTGGAAGGTGG + Intronic
937845375 2:126573475-126573497 AAGGGCCCTCCCCAAGGATGCGG + Intergenic
940110762 2:150150352-150150374 AAAGTCCATCTGCAGGGATGTGG + Intergenic
942660753 2:178262663-178262685 AGTCTCCCTCTTTAGGGATGTGG + Intronic
944599124 2:201285249-201285271 AGGTTCCCTCTGCAGGGTTTCGG - Exonic
944639643 2:201710662-201710684 AAAGACCCTCTCCAGGGGTGAGG + Intronic
947518762 2:230828553-230828575 CGGGGCCCTCTGCAGGGACGCGG - Intergenic
948677729 2:239608894-239608916 AGGGGCCCTCTCCACGGAGAAGG + Intergenic
949010007 2:241672986-241673008 AGTGTCCCTTTCCAGTGCTGTGG + Exonic
949085230 2:242148131-242148153 AGGGTCTCTTTCCAGGGTTAAGG - Intergenic
1168826854 20:819792-819814 AGGGTGCCTCTCCTGAGCTGGGG + Intergenic
1172773373 20:37394047-37394069 AGAGTGCCTCTCCTGGGCTGGGG + Intronic
1174410494 20:50331799-50331821 AGGGTCCCACTCCAGAGAAAAGG - Intergenic
1174572051 20:51508906-51508928 AGGATCCCTCTGCTGGGGTGTGG - Intronic
1175364500 20:58443000-58443022 CATGTCCCTCTTCAGGGATGTGG + Intronic
1175803130 20:61812378-61812400 AGGGCAGCTCTCCAGAGATGGGG + Intronic
1175816243 20:61884604-61884626 AGGTTCCCTCGCCTGGGGTGGGG - Intronic
1182030417 22:27155058-27155080 AGGGTGTCTCTCCTGGGTTGGGG - Intergenic
1182620661 22:31616788-31616810 AGGGACACTGGCCAGGGATGAGG - Exonic
1183935321 22:41258545-41258567 GGCGTCCTTCTCTAGGGATGAGG + Intronic
1184337377 22:43861949-43861971 AGGCTCCATCTCCACGGAAGGGG + Intronic
1184504533 22:44892947-44892969 AGCGTCCATACCCAGGGATGGGG - Intronic
1185420571 22:50732128-50732150 AGGGTCTCTCCCCAAGGAGGGGG + Intergenic
949207281 3:1455192-1455214 AAGTTCCCCTTCCAGGGATGGGG + Intergenic
950759336 3:15206503-15206525 AGCGTCCCGCTCCAGTGCTGTGG - Exonic
951926639 3:27915176-27915198 AGGGCCCCTCTCCAAGGACCTGG - Intergenic
955352056 3:58200910-58200932 TGAGTACCTCTCCAGGGAGGGGG - Intronic
955803898 3:62713806-62713828 AGTGTCACTCTCCAGGGACTTGG + Intronic
959815626 3:110670636-110670658 AGGGCCCCCCTGCAGGGATTTGG + Intergenic
962144424 3:132825206-132825228 AGGGTCCTTCACCAGGGATTTGG - Intergenic
962982587 3:140504087-140504109 AGGCTCCCTCTCTAGTGATCTGG - Intronic
963732541 3:148987223-148987245 GGGGGCCCTCTCCAGGGACTGGG - Intergenic
968636884 4:1685251-1685273 GGGGCCCCTCGCCAGGGGTGGGG - Intergenic
974317800 4:60305491-60305513 AGAGTCCTTCTCCAGTCATGTGG - Intergenic
976392327 4:84518226-84518248 TGGGACCCTATCCAGAGATGGGG + Intergenic
979262664 4:118666377-118666399 AGGGTCTCTTTCCAGGGTTAAGG - Intergenic
980412858 4:132446451-132446473 ATGCTCCCTCTACAGGGATTGGG - Exonic
983937543 4:173512672-173512694 AGTGTCCCTTGCCAGGGATGGGG - Intergenic
985510888 5:313135-313157 AGGGTCACTCTCCAAGGGTGGGG - Intronic
985710168 5:1423393-1423415 AGGGTCCCTCTCCAGGGATGAGG + Intronic
987101629 5:14596284-14596306 GGCATCCCTCTCCAGGGATGAGG + Intronic
988487570 5:31679338-31679360 AGGTTCCCTCTCCAAAGCTGAGG + Intronic
989196601 5:38722750-38722772 GGGGTCTCTCTGCAAGGATGGGG + Intergenic
989491380 5:42059928-42059950 TGGAGCCCTCTCCAGGGATTCGG - Intergenic
992623810 5:78618717-78618739 AGGGTCCCTCTCCTTGAATCTGG - Intronic
993025147 5:82636944-82636966 AGGGGCCCTCTACAGGGCTTGGG - Intergenic
994803977 5:104419519-104419541 AGGGACCCTCTCCAAGGACCTGG - Intergenic
998072338 5:139207794-139207816 AGGGCCCTTCTCCAGGGCAGGGG + Intronic
998414958 5:141939563-141939585 AGGCTCCCTCTTTAGGGCTGAGG - Exonic
1000728264 5:164799980-164800002 AGGCTCCATCTTCAGGTATGAGG - Intergenic
1002045626 5:176540334-176540356 AGGGTCGCTTTCCTGGGGTGGGG - Intergenic
1002575384 5:180171118-180171140 GGGGTCCCACTCCTGGGCTGGGG - Intronic
1002737360 5:181404953-181404975 AGGGTCTCTTTCCAGGGTTAAGG - Intergenic
1004964534 6:20833413-20833435 AGTATCCCTCTTCAGGGAAGTGG - Intronic
1006794431 6:36722591-36722613 GGGGTCCCCCTCCAGCCATGGGG - Exonic
1007430877 6:41776137-41776159 AGGCTCCCTCTACAGAGAGGTGG + Intronic
1007515970 6:42411678-42411700 AGCTGCCCTCACCAGGGATGAGG + Intronic
1007684217 6:43655703-43655725 GGGGCCCCTCTCAAGGGCTGGGG + Intronic
1007728430 6:43931148-43931170 AAGGTCACACTCCAGGCATGTGG + Intergenic
1007730266 6:43941266-43941288 AGGGCCCTTCTCCTGGGATCTGG + Intergenic
1007825905 6:44600379-44600401 ATGGTCCCTCCCCAGGAATCAGG - Intergenic
1008866960 6:56223976-56223998 AGTGTCTCTCTCCTGGGATAAGG + Intronic
1014134129 6:117867754-117867776 TGGGTCCCTCTCATGGCATGTGG + Intergenic
1018620353 6:165724870-165724892 AGGTTCCCTGGTCAGGGATGAGG + Intronic
1018774396 6:166999599-166999621 CCGGTCCCTCGCCAGGGAGGCGG - Intronic
1019242455 6:170680509-170680531 AGGGTCTCTTTCCAGGGTTAAGG - Intergenic
1019305528 7:332733-332755 AGGAGCCCTCTCCTGGGGTGGGG - Intergenic
1019628119 7:2031691-2031713 ACGGCCCCTCACCAGGGAGGAGG + Intronic
1020098707 7:5382517-5382539 AGGGTTGCTCTCCAGGGGTCCGG + Intronic
1020686479 7:11302041-11302063 AAGGTCCTGCTACAGGGATGAGG + Intergenic
1024083660 7:45876276-45876298 AGGGTTCCTCACCAGGTAAGAGG - Intergenic
1024862277 7:53858585-53858607 AGGGTCCATCATCATGGATGTGG - Intergenic
1034412958 7:150950732-150950754 AGGGGAGCTCTCCAGGGAAGGGG + Intronic
1034480797 7:151319188-151319210 AGTTTCTGTCTCCAGGGATGAGG - Intergenic
1034555202 7:151845876-151845898 AGGGTCCCTCTCCCGGCATCTGG + Intronic
1035300172 7:157891875-157891897 AGGCTCCCTCAGCAGAGATGGGG + Intronic
1035505662 8:127645-127667 AGGGTCTCTTTCCAGGGTTAAGG + Intergenic
1035582998 8:752032-752054 AGGGTCTCCCTCCAGGGCTCTGG + Intergenic
1036786175 8:11689149-11689171 ACTGTCCCTCCCCAGGGATGGGG + Intronic
1037672216 8:21024800-21024822 AGGGTCCCTCCCATGGCATGTGG + Intergenic
1043516940 8:81003387-81003409 AGGTTCCAGCTCCAGGGATCCGG - Intronic
1045510440 8:102808664-102808686 TGGGGCCCCCTGCAGGGATGTGG - Intergenic
1048997822 8:139805019-139805041 AGGACCCCTCTCCAGGGGAGGGG - Intronic
1049709326 8:144056577-144056599 AGGGCCCCTTGCCAGGGATCCGG + Intronic
1054907134 9:70421134-70421156 AGGCTCCCTATCCAGGAACGTGG + Intergenic
1055771911 9:79726166-79726188 ATGGACTCTCTCCTGGGATGAGG + Intronic
1056451541 9:86721743-86721765 AGGGACCCTCTCCAGAGCGGGGG - Intergenic
1057874319 9:98742565-98742587 AGGATCTTTCTCCAGGGAAGTGG + Intronic
1058164516 9:101605013-101605035 TGGGTCCCTGGCCAGGGATGGGG + Intronic
1059390886 9:113999030-113999052 GGGCTCCCTCTGCTGGGATGTGG + Intronic
1059434971 9:114270634-114270656 AGGGTCCTGCCCCAGGGAGGGGG + Intronic
1060245864 9:121945851-121945873 AGGGTGACTTTCCAGGGAAGTGG - Intronic
1060413615 9:123415734-123415756 AGGGCCCTGCTGCAGGGATGCGG + Intronic
1060548949 9:124476277-124476299 AGGGCCCCACTCCCAGGATGGGG + Intronic
1060984322 9:127810847-127810869 AGGCTGCATCTCCAGAGATGTGG + Intronic
1061370299 9:130194007-130194029 TGGATCCATCTCCAGGGTTGAGG - Intronic
1061592273 9:131605367-131605389 AGGGCCCTTCTCAAGGGAGGAGG - Intronic
1062457741 9:136647348-136647370 AGGCTTCCTCTCCAGGACTGGGG + Intergenic
1062475015 9:136722466-136722488 AAGGAGCCTCTCCAGGGCTGGGG + Intronic
1062483934 9:136764924-136764946 AGGCCCCCTCTCCTGGGATCTGG + Intronic
1062744494 9:138202692-138202714 AGTGCCCTTCTCCAGGGCTGGGG - Intergenic
1203602646 Un_KI270748v1:29733-29755 AGGGTCTCTTTCCAGGGTTAAGG - Intergenic
1185611766 X:1397443-1397465 GGAGTCCCTTTTCAGGGATGAGG - Intergenic
1186339812 X:8632104-8632126 AGAGTCCCTCACCTGGGAAGTGG - Intronic
1186500269 X:10045185-10045207 AGGCTGCCTCTCCAGGGAAAGGG + Intronic
1191899787 X:66028868-66028890 AGAGCCTCTCCCCAGGGATGGGG + Intronic
1192633052 X:72791712-72791734 AGGGGCTCTCTCCAAGGTTGAGG + Intronic
1192648657 X:72929089-72929111 AGGGGCTCTCTCCAAGGTTGAGG - Intronic
1195402723 X:104478711-104478733 AGTGATTCTCTCCAGGGATGTGG - Intergenic
1198962796 X:142200714-142200736 AGGGAACTTCTGCAGGGATGAGG + Intergenic