ID: 985711558

View in Genome Browser
Species Human (GRCh38)
Location 5:1432395-1432417
Sequence GGTCCCCCATGGTAGCCCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 98}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985711558_985711562 6 Left 985711558 5:1432395-1432417 CCAAGGGGCTACCATGGGGGACC 0: 1
1: 0
2: 1
3: 10
4: 98
Right 985711562 5:1432424-1432446 CGCCATCTCTCCCGTTCCCGAGG 0: 1
1: 0
2: 2
3: 4
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985711558 Original CRISPR GGTCCCCCATGGTAGCCCCT TGG (reversed) Intronic
900697867 1:4023346-4023368 GCTCCTCCATGCCAGCCCCTGGG - Intergenic
912542902 1:110430490-110430512 CCTGCCCCCTGGTAGCCCCTAGG + Intergenic
915574558 1:156767213-156767235 AGTTCCCTAGGGTAGCCCCTTGG - Intronic
921070965 1:211657080-211657102 TCTCCCCCATGGCAGCCCCATGG + Intergenic
1063091009 10:2866320-2866342 GCACCCCGAGGGTAGCCCCTGGG + Intergenic
1064028274 10:11866751-11866773 GGTCCCCTCTGGAAGGCCCTCGG - Exonic
1066005366 10:31141748-31141770 GGGCCTCCATGCCAGCCCCTTGG - Intergenic
1067157977 10:43798847-43798869 GGTCCCCCATGATGGACACTGGG + Intergenic
1069697666 10:70398865-70398887 AGTCTCCCATGGTAGGCTCTGGG + Intergenic
1070618507 10:77988051-77988073 GGGCCCCCGAGGTAGCCCCTTGG - Intronic
1075794586 10:125110030-125110052 GGTCACCCATGTGTGCCCCTGGG + Intronic
1076555862 10:131321052-131321074 GGTGCCCCAGGCCAGCCCCTCGG - Intergenic
1077136185 11:1000332-1000354 CCTCCCCCATGGCACCCCCTTGG - Intronic
1078095204 11:8292374-8292396 GGTGCCAGATGTTAGCCCCTAGG + Intergenic
1082236355 11:49823221-49823243 ACTCCCCCTTGGAAGCCCCTGGG + Intergenic
1082239806 11:49857729-49857751 ACTCCCCCTTGGAAGCCCCTGGG + Intergenic
1082242346 11:49886622-49886644 ACTCCCCCTTGGAAGCCCCTGGG - Intergenic
1082656837 11:55867427-55867449 ACTCCCCCTTGGAAGCCCCTGGG - Intergenic
1083618608 11:64038116-64038138 GGCCTCCCATGAAAGCCCCTGGG + Intronic
1083684501 11:64368402-64368424 GGTCCCACCTGGTAGCCCCGCGG - Intronic
1084959926 11:72711078-72711100 GGTCCCCGATGGCAGCCACGTGG + Exonic
1086138037 11:83462380-83462402 TATCCTCCATGGTAGGCCCTAGG + Intronic
1087128872 11:94651953-94651975 GGTTCCCCATGTTTGCCCCTGGG - Intergenic
1089688684 11:120172745-120172767 GGTCCCCCATGGGAGGGCGTGGG - Intronic
1091912800 12:4245322-4245344 GCCCCCCCATCGTACCCCCTGGG - Intergenic
1102212655 12:111138522-111138544 GTTTCCCCATGGCAGCCCCCAGG + Intronic
1104983579 12:132584633-132584655 GGTCCCCCAGCAGAGCCCCTGGG + Exonic
1111966616 13:94867892-94867914 GGACCACCATGGCAGCCCATAGG + Intergenic
1118611879 14:67547656-67547678 GGTCCCCCAGGGAAGCACCCAGG - Intronic
1120049375 14:79847492-79847514 TGTCCCCCATGCCAACCCCTGGG + Intronic
1121738623 14:96236090-96236112 GGTCGTCAATGGAAGCCCCTTGG + Intronic
1121901423 14:97696694-97696716 GGACCCCCTTGGTAGTCCCATGG + Intergenic
1122929371 14:104926333-104926355 CTTCCCCCATGGTGGCACCTGGG + Intronic
1124696935 15:31870957-31870979 GCTCTCCCATGCTTGCCCCTCGG + Intergenic
1132394654 15:101463925-101463947 AGGCCCCCATGGTAGCCCCAGGG + Intronic
1135829089 16:25757737-25757759 TGGCCCCCATGGTAGCCTCCAGG - Intronic
1137053854 16:35734352-35734374 GGTGCCCCATGGTCTCCGCTTGG + Intergenic
1137737876 16:50738469-50738491 GGTACCCCGTGGTAGGCACTGGG + Intergenic
1142179031 16:88658261-88658283 GGACTCCCAGGGGAGCCCCTGGG + Intronic
1142185542 16:88693190-88693212 GGTCCCCCATGGAGGCCTCTGGG + Intergenic
1142412209 16:89922674-89922696 GGACGCTCATGGCAGCCCCTTGG + Intronic
1143377656 17:6476932-6476954 GGGCCCCCATGGAAGGGCCTGGG + Intronic
1143724511 17:8836115-8836137 CGTCCCCCATGGAAGCCCTCTGG + Intronic
1148679623 17:49466245-49466267 AGTCCCCCATGGCAGGCGCTGGG + Intronic
1149970253 17:61210871-61210893 GTTTCCCCATGATAACCCCTAGG - Intronic
1149986565 17:61352216-61352238 GGCCCCTCCTGGGAGCCCCTTGG + Intronic
1151884134 17:76913497-76913519 GGTGCCCCATGGAGGCCACTGGG + Intronic
1152584511 17:81183034-81183056 GTTACCCCATGGGAGCCCCTTGG - Intergenic
1153499121 18:5730369-5730391 GGTACCCCATGGCAGGCCCAAGG - Intergenic
1156296961 18:35801325-35801347 GGGCCCCCTTGGATGCCCCTGGG + Intergenic
1160500876 18:79400600-79400622 CGTCCCCCGCCGTAGCCCCTCGG - Intronic
1160957008 19:1698495-1698517 GGAACCCCATGGTGCCCCCTGGG + Intergenic
1163643047 19:18472676-18472698 AGGCCCCCAGGATAGCCCCTTGG - Intronic
1166539249 19:43594739-43594761 GGACCTCCATGGTCGCACCTAGG + Intronic
1167077998 19:47260635-47260657 GGCCCCCCTTGCTGGCCCCTGGG - Exonic
925082311 2:1080056-1080078 GGTCCTCCATGAGAGCCCCACGG + Intronic
925615858 2:5744033-5744055 GGTCTCTCATGGTGGCCCCAGGG + Intergenic
932722101 2:74145957-74145979 GTTCCCCCATGGTAGCCATTGGG - Intronic
934589214 2:95531118-95531140 CTTCCCCCTTGGAAGCCCCTAGG + Intergenic
937296451 2:120812524-120812546 GGTCCCCCATGGTGGCAGCACGG - Intronic
947006294 2:225514934-225514956 AGTCCCTCATGAAAGCCCCTTGG + Intronic
1171400145 20:24867937-24867959 GATCCACCATGGAAGCCCCAGGG + Intergenic
1172133694 20:32673263-32673285 TGTCCCCCATGGCAGCCACAGGG - Intergenic
1172167227 20:32906795-32906817 GGTCCCCAGTGGAGGCCCCTGGG + Intronic
1172630989 20:36378047-36378069 TGTCCCCCAGGAGAGCCCCTGGG + Intronic
1177608263 21:23410080-23410102 GGTCCCCCATTGTAGCCCCAAGG - Intergenic
1178390661 21:32195484-32195506 GGTGCCCCATGCTAGCCAGTTGG + Intergenic
1180947676 22:19705560-19705582 GTTCCCTCCTGGGAGCCCCTGGG - Intergenic
1181056288 22:20261928-20261950 ACTCCCCCATGGCTGCCCCTAGG - Intronic
1181355826 22:22295254-22295276 TGTCCCCCATGGTGTCCCCAGGG + Intergenic
1183308233 22:37095406-37095428 AGTCCACCATGGCATCCCCTGGG + Intronic
1184356490 22:43983928-43983950 GGTCCCCCAAGGTAAAACCTAGG - Exonic
959822503 3:110753134-110753156 GGCTTTCCATGGTAGCCCCTGGG - Intergenic
959862179 3:111229074-111229096 GGTCACCCATGTTATGCCCTAGG + Intronic
963489568 3:145982673-145982695 GCTCTACCATGGTGGCCCCTTGG + Intergenic
969566724 4:7983155-7983177 TGTCCCCCACGGTGGCCCCTTGG + Intronic
976149751 4:82079973-82079995 GGTCCCCCATGGTATTCCCCAGG + Intergenic
976906334 4:90240763-90240785 GGTGCCCAATTTTAGCCCCTTGG + Intronic
979429982 4:120617671-120617693 GGTCCCCCATCTCAGCTCCTGGG - Intergenic
981802940 4:148679379-148679401 GGCTCATCATGGTAGCCCCTAGG - Intergenic
985711558 5:1432395-1432417 GGTCCCCCATGGTAGCCCCTTGG - Intronic
988520311 5:31939585-31939607 GGTACCACATGGTAGCACGTGGG + Intronic
992672710 5:79075873-79075895 GGTACCCCATGGCAGCATCTAGG + Intronic
997719264 5:136064961-136064983 GCACCCCCATGTTAGACCCTGGG + Intergenic
999337078 5:150730099-150730121 AGTCCCGCATGATAGCCACTAGG - Intronic
1001246464 5:170108664-170108686 GGTCCTCCATGCCAGCCCCACGG + Exonic
1003652078 6:7970158-7970180 GGTGATCCATGGTGGCCCCTAGG + Intronic
1005989138 6:30892406-30892428 GGTCCCCCAGGTTGCCCCCTAGG - Exonic
1006443593 6:34066950-34066972 GCTTCCCTATGGAAGCCCCTGGG - Intronic
1007751743 6:44075433-44075455 GGGCCCCCTTGGTGGCCCCCAGG - Intergenic
1007956437 6:45921942-45921964 CCTCCCCCATGTGAGCCCCTGGG - Intronic
1011702154 6:89965850-89965872 GGCCTCCCCTGGTAGCACCTGGG - Intronic
1015174893 6:130296090-130296112 GGTCCCCCATGGGACCCCGTGGG - Intronic
1018704116 6:166450476-166450498 GGTCTCCCAGGGTGGTCCCTGGG - Intronic
1018704174 6:166450637-166450659 GGTCTCCCAGGGTGGTCCCTGGG - Intronic
1018845191 6:167551165-167551187 CGTCCCCCAGGGTGCCCCCTTGG + Intergenic
1027794309 7:82673408-82673430 TGTCCCATATGATAGCCCCTAGG + Intergenic
1029700894 7:102246290-102246312 GGGCTCCCAAGGTAGCCCCAGGG + Intronic
1031978768 7:128110741-128110763 GGTTCCCCAGGGAAGGCCCTGGG + Intergenic
1037933617 8:22899393-22899415 GCTCCCTCATGGAAGCCCTTTGG - Intronic
1040902593 8:52431958-52431980 GGTCCCATATGGAAGCTCCTAGG + Intronic
1051338019 9:16084664-16084686 GGGCCCCCATGGCAGCCCGGAGG - Intergenic
1053308794 9:37002406-37002428 CCTCCCCCATGGTCACCCCTTGG - Intronic
1053468588 9:38328531-38328553 GGTGGGCCATGGCAGCCCCTCGG + Intergenic
1060735495 9:126064288-126064310 TGACCCCCATGGTAGTCCTTGGG + Intergenic
1061962216 9:133993866-133993888 GGACCCCCATCGGAGGCCCTGGG - Intergenic
1189317869 X:40068547-40068569 TGTCTCCCTTGGTAGCCACTTGG - Intronic
1191249534 X:58253852-58253874 GGTCGTCCATGGTAGCACCCAGG + Intergenic
1191848843 X:65570687-65570709 GTTCCCCTAGGGTAGACCCTGGG - Intergenic
1193232644 X:79066342-79066364 AGTCCCTCATCGTAGCACCTGGG + Intergenic