ID: 985712638

View in Genome Browser
Species Human (GRCh38)
Location 5:1438312-1438334
Sequence TCAGAACGAAGCTGGCGGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 95}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985712633_985712638 -3 Left 985712633 5:1438292-1438314 CCCTCCTCTGGGACTAGTCTTCA 0: 1
1: 0
2: 1
3: 10
4: 146
Right 985712638 5:1438312-1438334 TCAGAACGAAGCTGGCGGCATGG 0: 1
1: 0
2: 1
3: 7
4: 95
985712629_985712638 17 Left 985712629 5:1438272-1438294 CCTGCGGCCACACTTTGCAGCCC 0: 1
1: 0
2: 0
3: 18
4: 179
Right 985712638 5:1438312-1438334 TCAGAACGAAGCTGGCGGCATGG 0: 1
1: 0
2: 1
3: 7
4: 95
985712635_985712638 -7 Left 985712635 5:1438296-1438318 CCTCTGGGACTAGTCTTCAGAAC 0: 1
1: 0
2: 0
3: 11
4: 71
Right 985712638 5:1438312-1438334 TCAGAACGAAGCTGGCGGCATGG 0: 1
1: 0
2: 1
3: 7
4: 95
985712630_985712638 10 Left 985712630 5:1438279-1438301 CCACACTTTGCAGCCCTCCTCTG 0: 1
1: 0
2: 2
3: 42
4: 311
Right 985712638 5:1438312-1438334 TCAGAACGAAGCTGGCGGCATGG 0: 1
1: 0
2: 1
3: 7
4: 95
985712634_985712638 -4 Left 985712634 5:1438293-1438315 CCTCCTCTGGGACTAGTCTTCAG 0: 1
1: 0
2: 1
3: 10
4: 141
Right 985712638 5:1438312-1438334 TCAGAACGAAGCTGGCGGCATGG 0: 1
1: 0
2: 1
3: 7
4: 95
985712627_985712638 25 Left 985712627 5:1438264-1438286 CCTTCCTTCCTGCGGCCACACTT No data
Right 985712638 5:1438312-1438334 TCAGAACGAAGCTGGCGGCATGG 0: 1
1: 0
2: 1
3: 7
4: 95
985712628_985712638 21 Left 985712628 5:1438268-1438290 CCTTCCTGCGGCCACACTTTGCA 0: 1
1: 0
2: 1
3: 8
4: 133
Right 985712638 5:1438312-1438334 TCAGAACGAAGCTGGCGGCATGG 0: 1
1: 0
2: 1
3: 7
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985712638 Original CRISPR TCAGAACGAAGCTGGCGGCA TGG Intronic