ID: 985718734

View in Genome Browser
Species Human (GRCh38)
Location 5:1477367-1477389
Sequence CCTTCCCCCATCGCCGAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 137}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985718734_985718738 19 Left 985718734 5:1477367-1477389 CCTGACTCGGCGATGGGGGAAGG 0: 1
1: 0
2: 1
3: 9
4: 137
Right 985718738 5:1477409-1477431 CATGACTCGCCGCACGTTGCTGG 0: 1
1: 0
2: 0
3: 0
4: 28
985718734_985718736 -5 Left 985718734 5:1477367-1477389 CCTGACTCGGCGATGGGGGAAGG 0: 1
1: 0
2: 1
3: 9
4: 137
Right 985718736 5:1477385-1477407 GAAGGAGCTGCTCACTTACTCGG 0: 1
1: 0
2: 3
3: 13
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985718734 Original CRISPR CCTTCCCCCATCGCCGAGTC AGG (reversed) Intronic
900037662 1:431010-431032 CTTTCCCCCATCGCAGCCTCGGG + Intergenic
900059292 1:666753-666775 CTTTCCCCCATCGCAGCCTCGGG + Intergenic
900511499 1:3063085-3063107 CCCACCCCCACCGCAGAGTCTGG - Intergenic
900542765 1:3212365-3212387 CCTGCCCCCACCGCCCACTCAGG - Intronic
901238774 1:7681051-7681073 CCTTCCCCCATCTCCACGCCCGG - Intronic
904360902 1:29971212-29971234 TCTTCCCCCATCCCAGGGTCAGG + Intergenic
904735799 1:32632029-32632051 CCTTACTCCATCGCCCAGGCTGG + Intronic
913592354 1:120341510-120341532 CCTCCCCCCACCCCCAAGTCTGG - Intergenic
913651005 1:120913635-120913657 CCTCCCCCCACCCCCAAGTCTGG + Intergenic
913699697 1:121362504-121362526 TCTTCCCCCATCCCCCACTCTGG + Intronic
914137847 1:144917532-144917554 TCTTCCCCCATCCCCCACTCTGG - Intronic
914170109 1:145215432-145215454 CCTCCCCCCACCCCCAAGTCTGG - Intergenic
914525226 1:148459395-148459417 CCTCCCCCCACCCCCAAGTCTGG - Intergenic
914598450 1:149176435-149176457 CCTCCCCCCACCCCCAAGTCTGG + Intergenic
915972682 1:160365543-160365565 CCTGCCCCCATCCCTGAGTCTGG - Intergenic
917433895 1:174999875-174999897 CCTCCCCGCCCCGCCGAGTCTGG - Exonic
920487107 1:206381213-206381235 TCTTCCCCCATCCCCCACTCTGG + Intronic
920615904 1:207492447-207492469 CCTACCCCCATCTCCAAGGCTGG - Intergenic
924764701 1:247021416-247021438 TCTTGCCCCATCACCGAGGCTGG - Intergenic
1064619523 10:17201359-17201381 CCTTCTCCTGGCGCCGAGTCTGG - Intronic
1065017489 10:21475353-21475375 CCTTCCCCCGTCACCCAGGCTGG - Intergenic
1072637104 10:97185392-97185414 CCTGCCCCCACCCCCAAGTCCGG + Intronic
1074050754 10:109879210-109879232 CCTTGCTCCATCGCCCAGGCTGG - Intronic
1075124262 10:119687114-119687136 CCTTCCCCCACCCCACAGTCTGG - Intergenic
1075173064 10:120133906-120133928 CCTTGCCCCATTGCCCAGACCGG + Intergenic
1075798131 10:125135430-125135452 CCATCCCCCATCGCCTCGTGGGG + Intronic
1076058236 10:127392744-127392766 CCCACCCCCAGCGCCGGGTCGGG + Intronic
1076964389 11:68933-68955 CTTTCCCCCATCGCAGCCTCGGG + Intergenic
1077412318 11:2409400-2409422 CCTTCCCAAATCACAGAGTCGGG - Intronic
1078982320 11:16550309-16550331 CCTTCCCCCAACCCCAAGACAGG - Intronic
1079635912 11:22740092-22740114 CTTTCCTCCAGCTCCGAGTCTGG + Intronic
1080158531 11:29143216-29143238 CCTCCCCCCTCCCCCGAGTCAGG + Intergenic
1080342795 11:31286774-31286796 CCTTCCCACATCAACCAGTCAGG + Intronic
1082821599 11:57547816-57547838 CCTTCCCACAGCTCCCAGTCTGG + Intronic
1083304336 11:61754810-61754832 CCTTCCCCCATCGCAGGGGCTGG - Intronic
1084453335 11:69252782-69252804 CCACCCCTCATCGCCGATTCAGG - Intergenic
1085331948 11:75659450-75659472 CCTTCCTCTATCGCCCAGGCTGG - Intronic
1088850546 11:113700038-113700060 CATTCCCCTATGGCCCAGTCTGG + Intronic
1092153762 12:6268866-6268888 CCTTCCCCCATCTAAGAGCCAGG + Intergenic
1094671127 12:32570209-32570231 TCTTGCCCCATCGCCCAGGCTGG - Intronic
1094822719 12:34239246-34239268 CCTTGCCACATCGCCCAGGCTGG + Intergenic
1097676099 12:62603551-62603573 CCTTCCCCCCGCGCCGCGCCCGG - Exonic
1102906853 12:116683158-116683180 CCGCCCCCCACCCCCGAGTCAGG + Intergenic
1103373682 12:120438493-120438515 CCTACCCCCATCTCCGCATCAGG + Exonic
1103942705 12:124509654-124509676 CCTTCCCCCTACACTGAGTCTGG - Intronic
1106157223 13:27170955-27170977 CTTTCCCCCAGCGCGGGGTCGGG + Intronic
1108418101 13:50221525-50221547 CCTTCCCCAATTGCCAACTCAGG - Intronic
1116391075 14:44390516-44390538 TCTTGCCCCATCGCCCAGCCTGG - Intergenic
1117736670 14:58775049-58775071 CCTTCTCCCATCCCCTAGTCTGG + Intergenic
1122136152 14:99634035-99634057 CCTTTCCTCACCACCGAGTCTGG - Intergenic
1122639685 14:103151576-103151598 CCTTCACCCATCTGCCAGTCAGG + Intergenic
1123448442 15:20345672-20345694 CCCACCCCCATCCCAGAGTCTGG - Intergenic
1123697869 15:22892027-22892049 CCTGCCCCCACCGCAGAGCCCGG + Intronic
1124802183 15:32843777-32843799 CCTTACTCCATCTCAGAGTCAGG - Intronic
1125852769 15:42920543-42920565 CCATCCCCCACCGCCGACTGCGG + Intronic
1126379536 15:48031643-48031665 CCTTCCCCCATCGCTGGCTCAGG + Intergenic
1130524140 15:84689216-84689238 CCTCCCTCCATCGCCCAGACTGG - Intronic
1132444161 15:101896250-101896272 CTTTCCCCCATCGCAGCCTCGGG - Intergenic
1132794723 16:1714136-1714158 CCTTCCCCCATGGCCAAGCAGGG + Intronic
1132903356 16:2270086-2270108 CCCTCCCCTAGCGCCGACTCTGG - Intergenic
1135609149 16:23849972-23849994 CCTTCCCTCATCCCAGATTCTGG + Intronic
1137388308 16:48060176-48060198 CCTCCCCCCATCGGCGACCCAGG + Intergenic
1142177172 16:88650672-88650694 ACTTCCTCCTTCGCGGAGTCGGG + Intronic
1143114981 17:4577092-4577114 CCTTCCCCCTTCTCAGAGACGGG - Intergenic
1145817437 17:27805689-27805711 ACTTCCGTCATCTCCGAGTCAGG - Intronic
1146204054 17:30886427-30886449 TCTTGCTCCATCGCCGAGGCTGG + Intronic
1148615116 17:48996048-48996070 CCCTCCCCCACCGCCCAGACGGG + Intergenic
1152340347 17:79720910-79720932 CCCACCCCCATCCCAGAGTCTGG + Intergenic
1152729136 17:81961272-81961294 CCTCCCCCCTCCGCCGAGCCCGG - Exonic
1155544103 18:26897726-26897748 CCTACCCCCATCCCCAACTCAGG + Intergenic
1157544634 18:48539261-48539283 CCTTCCCCCACCCCCGACTCGGG + Exonic
1158395998 18:57078730-57078752 CCCTCCCCCTTCTCAGAGTCAGG + Intergenic
1160641192 19:138565-138587 CTTTCCCCCATCGCAGCCTCGGG + Intergenic
1162340066 19:10086739-10086761 CCTTCCCCCAACGCCCTGTGGGG + Intronic
1162760660 19:12886385-12886407 CCTTCCCCCATCCCCGAGTGTGG - Intronic
1166367357 19:42284357-42284379 CCCTCCTCCCTCGCGGAGTCCGG - Intronic
1168417341 19:56176874-56176896 CCTTCCCCCATCATCGGATCAGG - Intronic
924982964 2:239984-240006 CCTTCCCCCAGCCCCTGGTCAGG + Intronic
931325420 2:61216886-61216908 TCTTGCCCCATCGCCCAGGCTGG - Intronic
933984595 2:87580299-87580321 CCTTCCCCCATCGATGAGGTTGG - Intergenic
935275678 2:101473980-101474002 CCCGGCCCCATCGCCGATTCGGG + Intronic
940509620 2:154596649-154596671 CCTTCCCCCATCCCAGCCTCTGG - Intergenic
946015220 2:216598893-216598915 CCATCCCCCATGGCTGAGACAGG + Intergenic
948433813 2:237938515-237938537 CCTTCCTCTGTCGCCCAGTCTGG - Intergenic
948942331 2:241202782-241202804 CCTTCCCCCTTGGCCGAGCAGGG + Intronic
1172868677 20:38120751-38120773 CCTGCCCCCATCACCAGGTCAGG + Intronic
1175635598 20:60580278-60580300 CCTCCCCCCATGGCGGTGTCTGG + Intergenic
1181489408 22:23252200-23252222 GGTTCCCCCATCCCCCAGTCTGG - Intronic
1183431161 22:37766523-37766545 CCTTCCCCCTCAGCAGAGTCTGG + Intronic
1183502629 22:38190020-38190042 TCTTGCTCCATCGCCGAGGCCGG + Intronic
952287233 3:31981018-31981040 GCTTCCCCCGCCGCCGAGCCCGG + Exonic
953968953 3:47332323-47332345 TCTTGCCCCATCGCCCAGGCTGG - Intronic
956135035 3:66089878-66089900 CCTTGCTCCATCTCCGAGGCTGG - Intergenic
965714820 3:171591602-171591624 CCTCCCCCCATCCCCCAGCCCGG + Intergenic
969135418 4:5025129-5025151 CCTTCCCCCTTCTCTGACTCAGG + Intergenic
969829240 4:9781790-9781812 CCTGTCCCCATCGCGGAGACTGG + Exonic
973315830 4:48759074-48759096 CCTTCCCCCAACGCCATGACAGG - Intronic
976848008 4:89512163-89512185 TCTTCATCCATCGCCGAATCAGG + Intergenic
985143377 4:186866298-186866320 TCTTGCCCCATCGCCCAGTCTGG + Intergenic
985718734 5:1477367-1477389 CCTTCCCCCATCGCCGAGTCAGG - Intronic
996787644 5:127257394-127257416 CCTTCCCCCAAAGCCCTGTCTGG - Intergenic
999270966 5:150296208-150296230 CATTCCCCCACCGCCTAGCCAGG + Intergenic
1001517634 5:172366964-172366986 TCTTGCCCCATCGCCCAGGCTGG + Intronic
1002142523 5:177151888-177151910 TCTTGCCCCATCGCCCAGGCTGG + Intronic
1002736159 5:181387856-181387878 CTTTCCCCCATCGCAGCCTCGGG - Intergenic
1002748539 6:86968-86990 CTTTCCCCCATCGCAGCCTCGGG + Intergenic
1005513128 6:26530013-26530035 CCTTCCACCTTCGCCCAATCAGG + Intergenic
1006111281 6:31747187-31747209 CCTTCCCCCATCTCCATGTACGG + Intronic
1006843242 6:37045077-37045099 CCTACCCCCATCTCCGCATCAGG + Exonic
1016581858 6:145636892-145636914 TCTTGCCCCATCGCCCAGGCTGG - Intronic
1019241255 6:170663384-170663406 CTTTCCCCCATCGCAGCCTCGGG - Intergenic
1019450297 7:1094197-1094219 CCTTCTCCCATCACCGGGGCTGG + Intronic
1019579214 7:1751711-1751733 GCCTCCCCCATCACCCAGTCCGG - Intergenic
1019667401 7:2258740-2258762 GCTGCCCCCACCGCCGAGTGTGG - Intronic
1021106012 7:16640549-16640571 CCTTCCTCCATCGCCCAAGCTGG + Intronic
1027216266 7:76185787-76185809 CCTTCCCCCAACACAGAATCAGG - Intergenic
1029543516 7:101198449-101198471 CCTACCCCCATCTCCAAGGCGGG + Intronic
1030324267 7:108203367-108203389 CCTTCCCCCATCCCCAGGACTGG - Intronic
1030970672 7:116051140-116051162 CCTTCCCCCAACCCCAAGACAGG - Intronic
1032129141 7:129214712-129214734 CCTTGCTCCATCGCCCAGGCTGG + Intergenic
1032529863 7:132611037-132611059 CCTTTCCCCATCTCTGAGACTGG + Intronic
1032567827 7:132966358-132966380 CCTGCCCCCATCGCCAAATCAGG + Intronic
1033815560 7:145068675-145068697 CCTTCCCCCAACCCCAAGGCAGG + Intergenic
1034729596 7:153374837-153374859 CCTTCCCCTATCCCAGGGTCTGG + Intergenic
1035506860 8:144711-144733 CTTTCCCCCATCGCAGCCTCAGG + Intergenic
1037374211 8:18210802-18210824 CCTTGCCCCATTGCCCAGGCTGG + Intronic
1037580998 8:20245972-20245994 CCTGCCCCCATCGCCTACCCCGG - Intergenic
1038039731 8:23714573-23714595 CCTTCCCGGATCGCTGATTCGGG + Intergenic
1041631508 8:60093849-60093871 TCTTCCCCCATCGCCAAATATGG - Intergenic
1044115338 8:88327970-88327992 CCATCCCGCATCCCCGAGGCAGG + Intronic
1049427108 8:142542509-142542531 CCTGCCCCCACCGCCCAATCTGG + Exonic
1049548786 8:143246868-143246890 CCGCCCACCATCACCGAGTCCGG + Intergenic
1049577997 8:143398390-143398412 CCTGCCCCCACCCCGGAGTCTGG - Intergenic
1052803525 9:32991745-32991767 CCTTGCCCTATCGCCCAGGCTGG - Intronic
1055266149 9:74498033-74498055 CCCTCCCCCATCTCCCCGTCTGG - Intronic
1057471164 9:95357926-95357948 CCTTCCTCCAGCCCCGAGTAGGG - Intergenic
1059248923 9:112871013-112871035 CCTTCCCACATCTCCCAGTGAGG - Exonic
1059438413 9:114289684-114289706 CCTTCCCCCAGCCCCCAGACTGG + Intronic
1062264672 9:135681590-135681612 CCTTCTCCAATCCCCGAGCCGGG + Intergenic
1203601447 Un_KI270748v1:12618-12640 CTTTCCCCCATCGCAGCCTCGGG - Intergenic
1186349411 X:8727773-8727795 CCTTCCACCATTCCCGAGTCTGG + Intronic
1186567124 X:10675384-10675406 CCCTCCCCCATCCCCAAGACAGG - Intronic
1188532873 X:31161959-31161981 CCTTCCCCCATCTCTCAGACTGG + Intronic
1197543817 X:127798914-127798936 CCTTACCCCATCACCTAGGCTGG - Intergenic
1197661833 X:129181755-129181777 CCTACTCCCATCGCCGAGGCTGG - Intergenic
1197734216 X:129838636-129838658 CCTTGCCCCATCACCCAGGCTGG - Intronic
1199200021 X:145076166-145076188 CCATCCCCCAACCCCCAGTCCGG - Intergenic
1199473863 X:148224672-148224694 CCTTACCCCATGGCAGACTCAGG + Intergenic