ID: 985720745

View in Genome Browser
Species Human (GRCh38)
Location 5:1487342-1487364
Sequence GAATGACTCAGAACCACGCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 48
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 45}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985720739_985720745 11 Left 985720739 5:1487308-1487330 CCGCCTCCACCCTCTGCATCTCT 0: 1
1: 0
2: 11
3: 142
4: 1209
Right 985720745 5:1487342-1487364 GAATGACTCAGAACCACGCGTGG 0: 1
1: 0
2: 0
3: 2
4: 45
985720738_985720745 18 Left 985720738 5:1487301-1487323 CCGCGTGCCGCCTCCACCCTCTG 0: 1
1: 0
2: 0
3: 34
4: 386
Right 985720745 5:1487342-1487364 GAATGACTCAGAACCACGCGTGG 0: 1
1: 0
2: 0
3: 2
4: 45
985720744_985720745 1 Left 985720744 5:1487318-1487340 CCTCTGCATCTCTGGTTCTGATC No data
Right 985720745 5:1487342-1487364 GAATGACTCAGAACCACGCGTGG 0: 1
1: 0
2: 0
3: 2
4: 45
985720742_985720745 5 Left 985720742 5:1487314-1487336 CCACCCTCTGCATCTCTGGTTCT 0: 1
1: 0
2: 3
3: 52
4: 599
Right 985720745 5:1487342-1487364 GAATGACTCAGAACCACGCGTGG 0: 1
1: 0
2: 0
3: 2
4: 45
985720741_985720745 8 Left 985720741 5:1487311-1487333 CCTCCACCCTCTGCATCTCTGGT 0: 1
1: 1
2: 7
3: 66
4: 541
Right 985720745 5:1487342-1487364 GAATGACTCAGAACCACGCGTGG 0: 1
1: 0
2: 0
3: 2
4: 45
985720743_985720745 2 Left 985720743 5:1487317-1487339 CCCTCTGCATCTCTGGTTCTGAT 0: 1
1: 0
2: 4
3: 38
4: 380
Right 985720745 5:1487342-1487364 GAATGACTCAGAACCACGCGTGG 0: 1
1: 0
2: 0
3: 2
4: 45

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985720745 Original CRISPR GAATGACTCAGAACCACGCG TGG Intronic