ID: 985721063

View in Genome Browser
Species Human (GRCh38)
Location 5:1489318-1489340
Sequence AGCCAGGCTGCCCCTACAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 330
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 304}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985721062_985721063 -10 Left 985721062 5:1489305-1489327 CCAAGCTAATGTCAGCCAGGCTG 0: 1
1: 0
2: 4
3: 26
4: 202
Right 985721063 5:1489318-1489340 AGCCAGGCTGCCCCTACAGCTGG 0: 1
1: 0
2: 1
3: 24
4: 304

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985721063 Original CRISPR AGCCAGGCTGCCCCTACAGC TGG Intronic
900635813 1:3664424-3664446 GGGCAGGCTGCCCCTCCTGCAGG + Intronic
901054724 1:6443828-6443850 TGCCATGCTGCCCCTGCTGCCGG - Intronic
901239035 1:7682283-7682305 AGACAGCTTGCCCCTGCAGCTGG + Intronic
902360621 1:15940939-15940961 GGACAGGCTTCCCCTGCAGCTGG + Intergenic
902436801 1:16403303-16403325 AGCTAGGCTCTCCCTACAGAGGG - Intronic
902737697 1:18412222-18412244 AGCCAGGCTGCAGATACAGGAGG + Intergenic
904392412 1:30194791-30194813 AGCCAGGAGGCCCATGCAGCAGG + Intergenic
906166747 1:43692105-43692127 ACCCAGGCAGCCCCTGCACCAGG - Intronic
906755682 1:48312312-48312334 AGTCAGTCTGCCCCTACTGGGGG - Intronic
907394157 1:54177979-54178001 AGGCAGGCTGCCCATGCTGCTGG + Intronic
908260544 1:62336784-62336806 AGCCTGGAGGCCCCTACACCTGG + Intergenic
909151184 1:72007483-72007505 AGCCAGGGTGCCCCTGAAGAAGG + Intronic
910381275 1:86629735-86629757 TGTCAGGCTGCCCCTACTGGGGG + Intergenic
910655104 1:89610618-89610640 AACCATGCTGCCCCCACACCAGG + Intergenic
911146535 1:94557859-94557881 AGCCACTCTGAACCTACAGCAGG - Intergenic
913043379 1:115052140-115052162 AGCCAGGCTATCCCCAGAGCAGG + Intronic
916884817 1:169057059-169057081 TGCCAGCATGCCCCTACACCTGG + Intergenic
916961024 1:169890052-169890074 TGCCAGGCTGCCAGTACTGCTGG - Intronic
917398352 1:174618388-174618410 TGTCAGTCTGCCCCTACTGCAGG - Intronic
920753372 1:208703435-208703457 TGTCAGTCTGCCCCTACTGCAGG - Intergenic
921842193 1:219840069-219840091 TGTCAGTCTGCCCCTACTGCGGG - Intronic
922816453 1:228452861-228452883 AGCCAGGCTTCCTGGACAGCAGG - Intergenic
923058616 1:230449233-230449255 TGCCAGGCTGCCCTGACAGAGGG + Intergenic
1063702620 10:8400280-8400302 AGCCAGGATGGCTCTGCAGCTGG - Intergenic
1066165831 10:32787894-32787916 CTCCAGGCTGACCCTACAGATGG + Intronic
1067044470 10:42976477-42976499 AGCCAGGCTGCCCCCAGGGAAGG + Intergenic
1068300655 10:55134177-55134199 AGCAAGGCTCCCCCTATAGCTGG - Intronic
1068680198 10:59811016-59811038 ATCCAGGCAGCCTCTAGAGCTGG + Intronic
1071236707 10:83657703-83657725 TGCCAGGCTGCCCCAGTAGCAGG - Intergenic
1073208295 10:101780125-101780147 AGCCAGGCCGCCCCTCCGCCGGG + Intronic
1073426272 10:103457530-103457552 AGGCAGCCTGCCCTCACAGCTGG - Intronic
1076250500 10:128980541-128980563 AGCAAGCCTGCACCTGCAGCAGG + Intergenic
1077155801 11:1090306-1090328 AGCCAGGCTCCCCTTGCTGCAGG + Intergenic
1077436051 11:2539726-2539748 AGCCTGGGGGCCCCTGCAGCAGG - Intronic
1077519942 11:3026979-3027001 AGGCAGGCTGCCTCCGCAGCGGG - Intronic
1077591793 11:3498300-3498322 TGTCAGTCTGCCCCTACAGGGGG + Intergenic
1078433306 11:11303924-11303946 AGCCAGGCAGCCCCTCCAAGGGG - Intronic
1078951751 11:16142098-16142120 TGTCAGGCTGCCCCTACTGGGGG - Intronic
1079392167 11:20032129-20032151 ACCAAAGCTGCCCCTGCAGCTGG - Intronic
1080432169 11:32209281-32209303 AGCCAGGCTTCCCTGACAGGAGG - Intergenic
1081620852 11:44618533-44618555 AGCCCGGAAGCCCCTACAGAGGG - Intronic
1082842209 11:57698945-57698967 AGCCAGGCTGGCCCAGCAACGGG + Exonic
1083677595 11:64335208-64335230 AGCCTGGCTGCACCTCCATCTGG - Intergenic
1083774158 11:64885052-64885074 AGCCAGGCTGCCCTATCACCGGG - Intronic
1084611169 11:70203787-70203809 AGCCTCGCAGCACCTACAGCCGG - Intronic
1084901286 11:72311776-72311798 AGCCAGGCTGCCTGTGCAGAGGG - Intronic
1087269693 11:96098745-96098767 AGCCTGCCTGCCCCAACAGCTGG + Intronic
1087828081 11:102788965-102788987 AGCCATGCTCCCTGTACAGCCGG + Intergenic
1088735486 11:112724664-112724686 AGCCTGGCTAACCCCACAGCTGG - Intergenic
1090841001 11:130487404-130487426 AGCCAGGCAGCCCCTGCCCCGGG - Intergenic
1090984842 11:131757044-131757066 AGACAGGCTGCCCCTGCTGAAGG - Intronic
1091582535 12:1798036-1798058 TGCCCGGCTGCCCCCACCGCAGG - Intronic
1092856579 12:12679765-12679787 AGGCAGGCTGACTCTAGAGCAGG - Intronic
1092864414 12:12747482-12747504 TGTCAGCCTGCCCCTACAGCAGG - Intronic
1094278646 12:28709013-28709035 TGCCAGGCTTGGCCTACAGCAGG - Intergenic
1099493560 12:83316166-83316188 AGCCATGCTTCCTGTACAGCTGG - Intergenic
1101379403 12:104201483-104201505 AGCCAGCCTCCCCAGACAGCTGG - Intergenic
1101832625 12:108271219-108271241 AGCCAGCTTGCCCCCAAAGCTGG - Intergenic
1104393233 12:128408919-128408941 AGCCAGGCTGCCCCATATGCTGG + Intronic
1104936355 12:132366419-132366441 AGCCAGGCCGCCCTGACAGCGGG - Intergenic
1105699727 13:22926847-22926869 AGCCCGGCTGCCCCGACGGCAGG + Intergenic
1106498685 13:30307056-30307078 AGCCCGGCGGCCCCGACCGCCGG - Intronic
1107631084 13:42343546-42343568 AGCCAGGCTTCCCCCAAAACTGG - Intergenic
1108547931 13:51515095-51515117 TGCCAGTCTGCCCCTACTGGGGG + Intergenic
1108715366 13:53073232-53073254 TGCCACGCTGCCCCTAGAGTAGG + Intergenic
1110760732 13:79227905-79227927 AGCCAGTCTTACTCTACAGCTGG - Intergenic
1111723282 13:91973879-91973901 TGTCAGTCTGCCCCTACAGGGGG + Intronic
1112367719 13:98769921-98769943 GGCCATGCGGCCCCTGCAGCTGG - Intergenic
1113568331 13:111334876-111334898 AGCCTGGCAGCCACTGCAGCGGG - Intronic
1114559164 14:23578339-23578361 ACCCAGCCTGCTCCTCCAGCTGG - Exonic
1114685469 14:24526686-24526708 TGTCAGTCTGCCCCTACTGCGGG - Intergenic
1114827166 14:26094877-26094899 ATACAGGCTGCTTCTACAGCAGG - Intergenic
1117446286 14:55806654-55806676 AGACAGGCTCCCCCTCTAGCAGG + Intergenic
1117945432 14:61014779-61014801 TGTCAGTCTGCCCCTACAGGGGG + Intronic
1118439788 14:65801908-65801930 AGACAGGCTGCCCCTGAAGCAGG - Intergenic
1119201140 14:72753782-72753804 ACCCAGGCTGTCCATACAGTAGG - Intronic
1121238631 14:92412077-92412099 AGCCAGTCTCCCTCTACAGAGGG + Intronic
1121787756 14:96675289-96675311 AACCAGGCAGCCCCAATAGCTGG - Intergenic
1121876225 14:97456038-97456060 ATCCTGACTGCCTCTACAGCAGG - Intergenic
1202862172 14_GL000225v1_random:89836-89858 AGCCAGGCTGCACCGGCAGAGGG - Intergenic
1125832479 15:42726543-42726565 AGCCAAGTTGCCCCTAGACCTGG + Intronic
1126269188 15:46792938-46792960 AGCTAGGCTTCCCACACAGCTGG + Intergenic
1126335040 15:47577732-47577754 AGACAGTCTGCCGCTCCAGCTGG + Intronic
1126894444 15:53243102-53243124 ATCCTGGCTGCCCCGACAGTGGG + Intergenic
1128245561 15:66130333-66130355 GGCAAGGCATCCCCTACAGCTGG - Intronic
1130181510 15:81634021-81634043 AGCCAGGCAGCCACCAGAGCTGG + Intergenic
1130570336 15:85036977-85036999 TGGCAGGCTGCCCCTGCAACTGG + Intronic
1131545752 15:93314416-93314438 AGCCATGCTCCCCCGACAACTGG - Intergenic
1131614486 15:94000772-94000794 AGCCAGGCTGGCCCCAGTGCTGG + Intergenic
1132047841 15:98579634-98579656 ACCCAGGCTGCCCTGAGAGCAGG - Intergenic
1132201464 15:99957159-99957181 AGCCAGGCGGCTCCTGCAACAGG + Intergenic
1132344607 15:101100784-101100806 TGCCAGGCTGCCCCCTCTGCTGG - Intergenic
1132615684 16:840227-840249 GGCCAGGCTGCCCCTCCACAGGG - Intergenic
1132770543 16:1560253-1560275 AGCCAGACTGCCTCCACCGCAGG + Intronic
1132995533 16:2820583-2820605 AGCCAGGCTGCCCCTCCCCCAGG + Intronic
1133222186 16:4323519-4323541 TGCCAGGCCGGCCCTGCAGCTGG + Intronic
1136371946 16:29842080-29842102 TGCCAGGCTGCAACTGCAGCTGG + Exonic
1136672903 16:31874032-31874054 GGCCCGGGTGCCCCTACAGCGGG - Intronic
1137718052 16:50611037-50611059 AGCCTCCCTGCCCCCACAGCTGG + Intronic
1138119647 16:54389150-54389172 AGCCAGGCTGCCCCTAGCTGCGG - Intergenic
1139451115 16:67028964-67028986 AGCCAGGCCGCTCCGCCAGCGGG + Intergenic
1141044387 16:80703539-80703561 AGCCACTCTGCCCTTACAGCAGG + Intronic
1141423836 16:83933098-83933120 GGCCATGCTGCTCCTACAGAAGG - Intronic
1141698509 16:85631946-85631968 AGCCACGCTGCCCCCAAGGCGGG - Intronic
1142164700 16:88579913-88579935 AGGCCTGCTGCCCCCACAGCAGG - Intronic
1145236889 17:21214556-21214578 CGCCAGGCTGCCTCTCCCGCTGG + Exonic
1146181017 17:30698088-30698110 AGCCGGGCTCCCCTTCCAGCTGG + Intergenic
1149033982 17:52114622-52114644 AGGCAGGTTGCCTCTATAGCTGG - Intronic
1150917530 17:69451764-69451786 ATACAGGCTGCCCCTGCAGAGGG + Intronic
1152122105 17:78425168-78425190 AGCCACGCTGACCCTAGAGAGGG - Intronic
1152228660 17:79104017-79104039 AGCCTGGCGGGACCTACAGCCGG + Intronic
1152303910 17:79510384-79510406 AGGCAAGCTGCCCCTGCTGCTGG + Intronic
1152686645 17:81696944-81696966 AGCCAGCCGGCCCCTGCCGCTGG + Exonic
1153820437 18:8827144-8827166 AGCCAGGCTGCTCCCGCAGATGG + Intronic
1153985030 18:10343932-10343954 AGCCCGCCGGCCCCTCCAGCAGG - Intergenic
1155036118 18:22026417-22026439 AACCAGGCTGGCCCTGCAGATGG + Intergenic
1156466737 18:37352648-37352670 AGGCAGCCTGGCCCTAGAGCTGG + Intronic
1156504312 18:37579477-37579499 AGGGAGGCTGCCCCAGCAGCTGG + Intergenic
1156505094 18:37585503-37585525 AGCTAGTCTGCTCCCACAGCAGG - Intergenic
1160450755 18:78964938-78964960 ACCCAGGCTGCCCCTCCACCCGG + Intergenic
1160450773 18:78965000-78965022 ACCCAGGCTGCCCCTCCACCCGG + Intergenic
1160450792 18:78965061-78965083 ACCCAGGCTGCCCCTCCACCCGG + Intergenic
1160450830 18:78965183-78965205 ATCCAGGCTGCCCCTCCACCCGG + Intergenic
1160450848 18:78965244-78965266 ACCCAGGCTGCCCCCCCACCCGG + Intergenic
1160450870 18:78965306-78965328 ACCCAGGCGGCCCCTCCACCTGG + Intergenic
1160748232 19:721215-721237 AGCCAGGGAGCCTCTAGAGCTGG + Intronic
1160777850 19:864467-864489 CGCCTGGCTGCCCCTCCACCAGG - Intergenic
1160800028 19:963489-963511 TCCCAGGCTGCCCCTGCACCAGG - Intronic
1160989244 19:1853866-1853888 GGCCAGGCAGCCCCTACCGTGGG + Exonic
1162977581 19:14217491-14217513 AGCCGGGCTCCCCTTTCAGCTGG - Intergenic
1163152902 19:15425337-15425359 AGCCAAGCGGCCCCTGCAGGAGG - Exonic
1164709750 19:30347347-30347369 TGCCAGGCTGCCCAAAAAGCAGG - Intronic
1164740288 19:30570858-30570880 CAACAGGCAGCCCCTACAGCTGG - Intronic
1166767873 19:45263196-45263218 AGCCAGGCTTCCGGCACAGCCGG + Intronic
1167268036 19:48493197-48493219 AGGCAGGCTGAGCCTAGAGCGGG - Intronic
1167465552 19:49649350-49649372 AGCCAGGCTGCACCTGCTGCTGG - Intronic
1168348121 19:55660630-55660652 GGCCAGGCTGCTCCCAGAGCGGG + Intronic
925388450 2:3479641-3479663 AGCCACGCAGTCCCTGCAGCTGG + Intronic
925905575 2:8537959-8537981 AGCCAGCCAGCCCCTTCTGCTGG + Intergenic
925978105 2:9155242-9155264 AGCCAGGCTGGCCCTAGCCCTGG + Intergenic
926695850 2:15769910-15769932 AGCCAGGCTGTCCCCATAGGAGG + Intergenic
927185604 2:20479993-20480015 AGGTAGGCTGCCCCTAAGGCGGG - Intergenic
927451489 2:23213030-23213052 TGCCAGCCTGCCCAGACAGCGGG + Intergenic
927888328 2:26731961-26731983 AGCCAGGGGGCCCCTACTGCAGG - Exonic
929812364 2:45201162-45201184 ACCCAGCCTGCCACCACAGCTGG + Intergenic
929899149 2:45986467-45986489 AGCCAGGCTTGCCCTCCATCTGG - Intronic
929965068 2:46528573-46528595 AACCAGGCTGCCCCTGGAACAGG + Intronic
932009408 2:67960288-67960310 AGCCAGGATGTACCAACAGCTGG - Intergenic
935938077 2:108208529-108208551 TGTCAGTCTGCCCCTACAGGGGG + Intergenic
937091976 2:119212541-119212563 AGCCAGACTCCTCCTACTGCTGG - Intergenic
937322097 2:120966983-120967005 AGGCAGGCTGCCCTGACTGCAGG - Intronic
937905067 2:127049148-127049170 GCCGAGGCTGCCCCTGCAGCTGG + Intronic
938546445 2:132337226-132337248 GGCCAGGCTTCCGCTACAGGAGG + Intergenic
938915400 2:135933945-135933967 ACCCCGTCTGCCCCTGCAGCTGG - Exonic
942411805 2:175717315-175717337 TGTCAGGCTGCCCCTACTGGGGG - Intergenic
943737668 2:191374618-191374640 AGCCAGGCAGCACTTCCAGCTGG - Intronic
944822081 2:203441217-203441239 AGCCAGTCTGCACCTTCTGCAGG - Exonic
945469541 2:210211687-210211709 AGCCATGCTTCCTATACAGCTGG + Intronic
946235611 2:218323055-218323077 AGCCAGGCCGCCCCCCAAGCCGG + Intronic
948503542 2:238411779-238411801 ACCCAGGCTGCCCCTACCCAGGG + Intergenic
948523664 2:238557760-238557782 GGCCAGTCTGCCCCTTCGGCGGG - Intergenic
1169219720 20:3815040-3815062 AGCCAGGCTGCCTCTATTGTGGG + Intergenic
1170483571 20:16793232-16793254 TGTCAGTCTGCCCCTACAGGGGG + Intergenic
1171896942 20:30816286-30816308 CGCCTGGCTGCCCCAAGAGCCGG + Intergenic
1173252872 20:41373949-41373971 AGCCAGGCTGAGCCTCCAGTTGG + Intergenic
1173315939 20:41943074-41943096 AGCCAGGCTGCTAGTAGAGCTGG + Intergenic
1173408892 20:42792171-42792193 AGCCATGCCACCCCTGCAGCTGG + Intronic
1173526364 20:43735915-43735937 AGCCCTCCTGCCCCTTCAGCAGG + Intergenic
1175097292 20:56551733-56551755 TGCCAGGCTGCTCCTGCTGCGGG - Intergenic
1175402209 20:58707219-58707241 ACCCAGGATGCCCCTGCAGAGGG - Intronic
1175684009 20:61013782-61013804 AGCCATGCTTCCTGTACAGCTGG - Intergenic
1175968283 20:62670897-62670919 AGCCAGGCTGACACTCCAGGAGG + Intronic
1176297248 21:5080672-5080694 AGTCGGGCTGCCCAGACAGCTGG + Intergenic
1176411190 21:6450409-6450431 AGCCATGCAGACCCTGCAGCTGG - Intergenic
1179049656 21:37878484-37878506 GGCCAGCCTGCCCTTCCAGCAGG + Intronic
1179490936 21:41741215-41741237 TGCCAGGCTGCTCCTGCATCGGG - Exonic
1179686683 21:43058731-43058753 AGCCATGCAGACCCTGCAGCTGG - Intronic
1179859781 21:44181276-44181298 AGTCGGGCTGCCCAGACAGCTGG - Intergenic
1180000445 21:44993139-44993161 AGCCATGCTGCCCCTGAAACGGG + Intergenic
1180718865 22:17891947-17891969 AGCCAGGCTGGCCACACAGTAGG - Intronic
1180843411 22:18969678-18969700 TGCCAGGCTGTCCCTGCACCTGG - Intergenic
1180962744 22:19769593-19769615 AGCCAGACAGCCCCCGCAGCGGG - Intronic
1181058055 22:20269048-20269070 TGCCAGGCTGCCCCTGCACCTGG + Intronic
1181107975 22:20585885-20585907 AACCAGGCTTCCACTGCAGCAGG + Intronic
1181514600 22:23403497-23403519 TGCCAGGCTGCCCCTGCACCTGG + Intergenic
1182328449 22:29532172-29532194 AGCCAGGGTGCCCTGACAGTAGG - Intronic
1182804106 22:33056470-33056492 AGCTAGGATGTCCCTTCAGCAGG - Intronic
1182861310 22:33561728-33561750 ACCCAGCCTGCACCAACAGCTGG - Intronic
1183000781 22:34856932-34856954 AGCAAGGCTGGGCCTACAGATGG + Intergenic
1183188096 22:36304000-36304022 GGCCAGGTAGCCCCTGCAGCAGG + Exonic
1183275670 22:36896001-36896023 AGTCAGGCTGCCACTCCAGTGGG + Intergenic
1185235811 22:49712320-49712342 AGACAGGCTGGCCCCAGAGCCGG + Intergenic
1185267822 22:49913723-49913745 AGGCAGGCGGCCCCTGCTGCTGG - Exonic
950196883 3:11015597-11015619 AGGCAGGCAGCTCCTACAGAGGG - Intronic
951025498 3:17824346-17824368 AGCCAGGGAGCAGCTACAGCAGG - Intronic
953909851 3:46886328-46886350 GGCCAAGCTGCCCCTGGAGCAGG - Intronic
954171369 3:48805367-48805389 AGCCAAGCTTCAGCTACAGCTGG + Intronic
954317491 3:49809093-49809115 AGCCAGGCAGCCCATGCATCTGG + Exonic
954430504 3:50468320-50468342 AGGGAGGCTGGCCTTACAGCAGG - Intronic
954685019 3:52365628-52365650 AGCCAGCCACCCCCTCCAGCAGG + Intronic
955672868 3:61420076-61420098 AGCCAGGCTGTTTCTACAACGGG - Intergenic
956579712 3:70796796-70796818 AGTCAGTCTGCCCCTACTGGGGG + Intergenic
956619387 3:71205658-71205680 AGGAGGGGTGCCCCTACAGCTGG - Intronic
956746732 3:72316632-72316654 AGGCAGGCTGCCCCTAACACTGG + Intergenic
957947946 3:87088914-87088936 AGCCATTCGGCCCCTACAGAAGG + Intergenic
958418655 3:93906837-93906859 AGCTAGGCTGCGACAACAGCTGG - Intronic
958980178 3:100710222-100710244 AACCAGGCTGGGCCTCCAGCCGG - Intronic
959131581 3:102363091-102363113 AGCCAGACTGTTCCTCCAGCTGG - Intronic
964335258 3:155648135-155648157 AGTCTGGCTACCCCTAGAGCTGG - Intronic
964993382 3:162844066-162844088 AAGCAGGCTGCCCAGACAGCAGG - Intergenic
967870462 3:194225104-194225126 AGCCAGCCAGCCCCCGCAGCAGG + Intergenic
967975371 3:195031368-195031390 AGCCAGGTTCCCCACACAGCTGG - Intergenic
968093507 3:195912009-195912031 AGCCAGTCTCCTCCTACATCTGG + Intergenic
968644292 4:1731240-1731262 AGGCAGGCTGCCCCTGCTGATGG - Exonic
968731875 4:2272988-2273010 TGCCAGGCTGCCCTTCCTGCTGG - Intronic
969187285 4:5485982-5486004 TGTCAGTCTGCCCCTACTGCGGG + Intronic
969592713 4:8130969-8130991 ATGCAGGCTGCCCCAAGAGCAGG - Intronic
969834881 4:9832454-9832476 AGCCAGGCTGGACATACAGATGG - Intronic
970290242 4:14563874-14563896 TGCTAGGCTGCCCCATCAGCTGG + Intergenic
972455943 4:39255325-39255347 AACCATGCTGCGCCTCCAGCTGG - Intronic
975352468 4:73360877-73360899 TGCCAGTCTGCCCCTACTGGAGG - Intergenic
976511010 4:85910113-85910135 AGCCAGGCTGCGGCTAGACCAGG + Intronic
976672146 4:87665615-87665637 AGCCAGGCTCCCCTCACATCAGG - Intergenic
977996046 4:103498242-103498264 AGGCAACCTGGCCCTACAGCTGG - Intergenic
978135824 4:105258013-105258035 AGCCAGGCTGCCACTAGAGGAGG - Intronic
978724656 4:111956060-111956082 AGCCAGGTTTCCCTTAAAGCAGG - Intergenic
980846347 4:138329841-138329863 GGCAAGGCTGCTCCTCCAGCCGG + Intergenic
981100610 4:140825745-140825767 GGTCAGGCTGCCCCTACTGGGGG + Intergenic
982171266 4:152663934-152663956 CGCCTGGCAGCCCCAACAGCTGG + Intronic
984826222 4:183927194-183927216 AGCCAGCCTGCTCCCACATCCGG - Intronic
985023475 4:185716194-185716216 CGCCAGCCTGCCCCAGCAGCAGG - Intronic
985356612 4:189126669-189126691 AGCCAGGCTTCCTGTGCAGCTGG - Intergenic
985721063 5:1489318-1489340 AGCCAGGCTGCCCCTACAGCTGG + Intronic
985733479 5:1564359-1564381 AGCCAGTCAGCCCCGGCAGCAGG - Intergenic
985816904 5:2134064-2134086 AGCCTGGCTGCCCAGCCAGCTGG - Intergenic
986385721 5:7231331-7231353 AGTCAGTCTGCCCCTACTGGGGG - Intergenic
986878950 5:12146837-12146859 AGCCATGCTTCCTGTACAGCTGG - Intergenic
987457985 5:18170275-18170297 AGCCAGGCAGTGCCTACTGCAGG + Intergenic
987475885 5:18392178-18392200 AGCCAGGCAGCAGCTGCAGCTGG - Intergenic
988201790 5:28077915-28077937 AGCCAGCCGGCCCCGCCAGCCGG - Intergenic
989684172 5:44065275-44065297 TGCCAGTCTGCCCCTACTGGGGG + Intergenic
989946055 5:50230839-50230861 TGTCAGTCTGCCCCTACAGGGGG - Intergenic
990511892 5:56497177-56497199 AGCCAGGGAGCACCCACAGCAGG + Intergenic
990665724 5:58069388-58069410 AGCCCGGCTGCCCCCAGTGCGGG + Intergenic
992636986 5:78734450-78734472 AGCCAAGCCGCCCCTGCATCTGG + Intronic
992688602 5:79221764-79221786 AGCTAGGTTGCTCCTACAGTGGG - Intronic
993095002 5:83471534-83471556 AGGCAGGCGGTCCCTACCGCAGG + Exonic
995106397 5:108381556-108381578 AGCCAAGGTGCCCCCTCAGCCGG - Exonic
996398195 5:123033989-123034011 TGCCAGGCTGGCCCAGCAGCAGG + Intronic
999570920 5:152919077-152919099 TGTCAGTCTGCCCCTACTGCAGG + Intergenic
999969775 5:156847671-156847693 AGCCAGCCTTCCCACACAGCTGG + Intergenic
1000824247 5:166024367-166024389 AGCCAGGCTGAACCTAAAGTAGG + Intergenic
1001143198 5:169162364-169162386 CGCCATGTTGCCCTTACAGCAGG + Intronic
1001281153 5:170387415-170387437 AGCCAGGCTGCCCTCATACCCGG + Intronic
1003260139 6:4509620-4509642 AGGCAGGCTGACCCTACTGGGGG - Intergenic
1006473697 6:34242180-34242202 ATCCAGGCTGCCCCCAGAGAAGG - Intronic
1006517046 6:34550910-34550932 ACCCAGGCTGCCCATGCAGCAGG - Intronic
1006716991 6:36126904-36126926 AGCAAGGCTGAAGCTACAGCTGG - Intergenic
1007761177 6:44134581-44134603 AGCCATGCTGCCCTTTCTGCTGG + Exonic
1011449018 6:87473174-87473196 AGGCAGGCTGCCCTGACTGCCGG - Intronic
1011663738 6:89616059-89616081 GGCCAGCCTGCAGCTACAGCGGG - Intronic
1012338330 6:98088445-98088467 TGTCAGTCTGCCCCTACTGCGGG + Intergenic
1012595148 6:101030712-101030734 TGTCAGTCTGCCCCTACTGCGGG + Intergenic
1014387397 6:120818666-120818688 TGTCAGTCTGCCCCTACAGGGGG - Intergenic
1016321012 6:142845940-142845962 AGGCAGGCTCCCCCTGCCGCAGG + Intronic
1018234820 6:161713803-161713825 CGCCAGGTTCCTCCTACAGCAGG - Intronic
1018708478 6:166479771-166479793 AGGCAAGCAGCTCCTACAGCGGG - Intronic
1018798488 6:167205416-167205438 AGCCAGGCTCTCCCTAAAGGTGG - Intergenic
1020849789 7:13337782-13337804 AGCCAGGATCCCCCTACAGCTGG - Intergenic
1021373808 7:19883035-19883057 TGTCAGTCTGCCCCTACTGCGGG + Intergenic
1022475569 7:30707456-30707478 GGCCACGCTGCCTCTACGGCAGG + Intronic
1022503952 7:30899032-30899054 ATCCTTGCTGCCCCTACCGCAGG + Intergenic
1022508087 7:30919081-30919103 AGCCAGGCTGCCCCTAGCAAGGG + Intronic
1023844908 7:44115117-44115139 AGCCAAGCTGCCTCGCCAGCTGG - Intronic
1023939216 7:44759388-44759410 GCACAGGCTGCCCCTGCAGCAGG + Exonic
1024310599 7:47965794-47965816 AGCCAGGATCCCCCAACACCTGG + Intronic
1025524405 7:61786583-61786605 AGCCAGTCTGCCTCTACTGGAGG + Intergenic
1025547765 7:62198801-62198823 AGCCAGTCTGCCTCTACTGGAGG + Intergenic
1026050573 7:66943183-66943205 AAACAGGCTGCCCCCACATCAGG + Intronic
1026847164 7:73704755-73704777 AGCCAGGTGGCCCCTCCTGCAGG + Intronic
1029059890 7:97786337-97786359 TGTCAGTCTGCCCCTACTGCAGG - Intergenic
1029733607 7:102453533-102453555 AGCCAGGCTGCCCCTTGGGCTGG + Exonic
1032228262 7:130051438-130051460 AGCCAGGCTGCCTCAAGAGGCGG - Exonic
1032842737 7:135727088-135727110 GGCCAGCCTGCCCCAGCAGCGGG - Intronic
1035319733 7:158020897-158020919 ACTCAGGCTCCCCCGACAGCCGG + Intronic
1038397519 8:27258004-27258026 AGTCTGGCTGCCCCTGCAGCTGG - Intronic
1039127121 8:34215670-34215692 TGTCAGTCTGCCCCTACTGCAGG - Intergenic
1039423093 8:37461019-37461041 TGTCAGTCTGCCCCTACTGCGGG - Intergenic
1040028637 8:42804251-42804273 AGCCAGGCTGACCCTGCCTCTGG - Intergenic
1045514443 8:102845069-102845091 AAACAGGCTGCCCAGACAGCTGG - Intronic
1046561086 8:115838185-115838207 AACCAGACTGCTCCTACAGTTGG + Intergenic
1047967234 8:130055181-130055203 CGCCTGGCTGCCTTTACAGCTGG + Intronic
1048037662 8:130692916-130692938 AGCCATGCTTCCTGTACAGCCGG - Intergenic
1048446600 8:134497679-134497701 AGCCAGGATGCCCCCGCTGCTGG + Intronic
1048446629 8:134497797-134497819 AGCCGGGATGCCCCAGCAGCTGG + Intronic
1048446671 8:134497974-134497996 AGCCAGGATGCCCCCGCTGCTGG + Intronic
1049299288 8:141861294-141861316 ACCCAGGCTGCCCCTCTATCAGG + Intergenic
1049427240 8:142542928-142542950 TGCCAGGCTGCCCCAAGGGCTGG - Intronic
1049578892 8:143401831-143401853 AGCCAGGATGCCCCGCCCGCTGG - Intergenic
1049624354 8:143613440-143613462 ACCCACGCTGGCCCTACACCGGG + Intronic
1049678573 8:143904739-143904761 AGGAAGGCTGCCCCAACTGCTGG - Intergenic
1049687923 8:143946405-143946427 GGCCAGGCTGCTCCGAGAGCCGG + Intronic
1050103437 9:2142000-2142022 AACCTGGCTGCTCCTACAGTAGG + Intronic
1050781395 9:9341255-9341277 AGTCAGGCTGAGCCTACAGATGG - Intronic
1052647388 9:31254106-31254128 GGCCAGGTTGCCCCTCCAGAAGG - Intergenic
1056766696 9:89448515-89448537 AGCCGGGCTGCCCCAGCACCAGG + Intronic
1056934922 9:90909095-90909117 TGCCAGGCTCCCAGTACAGCTGG + Intergenic
1057142933 9:92738437-92738459 AGCCAGGCAGCCCCACTAGCTGG - Intronic
1058912470 9:109533761-109533783 AACCACGCCGGCCCTACAGCAGG - Intergenic
1059550276 9:115222200-115222222 AGCCAGGTTGCCCATAAGGCTGG + Intronic
1060839365 9:126781851-126781873 TCCCAGGCTGCCCTTCCAGCAGG - Intergenic
1061507280 9:131038529-131038551 AGCCAAGCTGCCACTCCAGAAGG + Intronic
1062064159 9:134517446-134517468 AGCCTGGCTCCCCCTAAAGCTGG + Intergenic
1062094410 9:134695482-134695504 CGTCAGCCTGCCCCTGCAGCTGG - Intronic
1062422467 9:136489712-136489734 AGCCTGGCGGCCCCTTCAGCAGG - Intergenic
1203740069 Un_GL000216v2:171123-171145 AGCCAGGCTGCGCCAGCAGAGGG + Intergenic
1203651786 Un_KI270751v1:132047-132069 TGTCAGTCTGCCCCTACAGGGGG + Intergenic
1186611080 X:11139098-11139120 ATCCAGGCTGCCGCTGCCGCGGG + Exonic
1186994712 X:15107633-15107655 AGCTAGGCTTCCCACACAGCTGG - Intergenic
1189348805 X:40262129-40262151 AGCCAGGCTGCTGCTGCTGCAGG - Intergenic
1192066762 X:67892691-67892713 AGCCATGCTTCCTGTACAGCCGG + Intergenic
1192157793 X:68759267-68759289 AGCCAGGCTGGCTCTGCAGCTGG + Intergenic
1192202416 X:69074986-69075008 AGTCAGGCTGCCTTAACAGCAGG - Intergenic
1192660458 X:73037075-73037097 TGTCAGTCTGCCCCTACTGCGGG + Intergenic
1192662880 X:73060402-73060424 TGTCAGTCTGCCCCTACTGCGGG - Intergenic
1192889107 X:75369278-75369300 AAGCAGGCTGCCTCTTCAGCAGG - Exonic
1195065882 X:101237715-101237737 AGCTCAGCTGCCCCTACAGGGGG + Exonic
1196699653 X:118654088-118654110 AGGCAGTCTGGCCCTAGAGCTGG - Intronic
1197260622 X:124313268-124313290 AGCCAGACTTCCCATACTGCTGG + Intronic
1200481488 Y:3708506-3708528 AGACATGCTACCCCTCCAGCTGG - Intergenic