ID: 985721824

View in Genome Browser
Species Human (GRCh38)
Location 5:1493516-1493538
Sequence GAGGGGCGTCGCCTATGGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985721824_985721835 22 Left 985721824 5:1493516-1493538 CCCGGCCATAGGCGACGCCCCTC No data
Right 985721835 5:1493561-1493583 GCACCGCCCACTGCCAACCCAGG 0: 1
1: 0
2: 0
3: 17
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985721824 Original CRISPR GAGGGGCGTCGCCTATGGCC GGG (reversed) Intronic