ID: 985724278

View in Genome Browser
Species Human (GRCh38)
Location 5:1507561-1507583
Sequence GGAAATGCAGAGATGAAGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 582
Summary {0: 1, 1: 0, 2: 7, 3: 55, 4: 519}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985724276_985724278 -9 Left 985724276 5:1507547-1507569 CCAGGTCACAGGTGGGAAATGCA 0: 1
1: 0
2: 2
3: 19
4: 204
Right 985724278 5:1507561-1507583 GGAAATGCAGAGATGAAGATGGG 0: 1
1: 0
2: 7
3: 55
4: 519
985724264_985724278 29 Left 985724264 5:1507509-1507531 CCCAGCAGAAGGCCCAGGGCTCC 0: 1
1: 0
2: 4
3: 36
4: 317
Right 985724278 5:1507561-1507583 GGAAATGCAGAGATGAAGATGGG 0: 1
1: 0
2: 7
3: 55
4: 519
985724268_985724278 17 Left 985724268 5:1507521-1507543 CCCAGGGCTCCTCAGCCGGGCTT 0: 1
1: 0
2: 2
3: 27
4: 221
Right 985724278 5:1507561-1507583 GGAAATGCAGAGATGAAGATGGG 0: 1
1: 0
2: 7
3: 55
4: 519
985724272_985724278 2 Left 985724272 5:1507536-1507558 CCGGGCTTGCTCCAGGTCACAGG 0: 1
1: 0
2: 4
3: 17
4: 284
Right 985724278 5:1507561-1507583 GGAAATGCAGAGATGAAGATGGG 0: 1
1: 0
2: 7
3: 55
4: 519
985724265_985724278 28 Left 985724265 5:1507510-1507532 CCAGCAGAAGGCCCAGGGCTCCT 0: 1
1: 0
2: 3
3: 32
4: 321
Right 985724278 5:1507561-1507583 GGAAATGCAGAGATGAAGATGGG 0: 1
1: 0
2: 7
3: 55
4: 519
985724271_985724278 8 Left 985724271 5:1507530-1507552 CCTCAGCCGGGCTTGCTCCAGGT 0: 1
1: 0
2: 0
3: 10
4: 172
Right 985724278 5:1507561-1507583 GGAAATGCAGAGATGAAGATGGG 0: 1
1: 0
2: 7
3: 55
4: 519
985724269_985724278 16 Left 985724269 5:1507522-1507544 CCAGGGCTCCTCAGCCGGGCTTG 0: 1
1: 1
2: 0
3: 29
4: 195
Right 985724278 5:1507561-1507583 GGAAATGCAGAGATGAAGATGGG 0: 1
1: 0
2: 7
3: 55
4: 519

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985724278 Original CRISPR GGAAATGCAGAGATGAAGAT GGG Intronic
900636875 1:3670226-3670248 GGTAAGGCAGGGATGATGATGGG + Intronic
900928599 1:5721417-5721439 GGCAAGGCACAGATGCAGATTGG - Intergenic
902190141 1:14756684-14756706 GGAGTTGAAGAGATGAAGTTAGG - Intronic
902543029 1:17167679-17167701 GAAAATGCAGAGAGGAAGATGGG + Intergenic
903310887 1:22454556-22454578 GGAAAGGGAGAGACGAAGCTGGG + Intronic
903587722 1:24428917-24428939 GGAAGTGCAGAGCTGCAGAAGGG - Intronic
905065527 1:35178126-35178148 AAAAATCCAGAGATAAAGATTGG + Intronic
905921907 1:41725237-41725259 GGACATGCAGACATGCAGCTGGG + Intronic
905949987 1:41942113-41942135 GGAAATGTAGATAAGAAGAAGGG - Intronic
906384489 1:45355757-45355779 GGAAATGCAGAGAGGAAATAAGG + Intronic
906465001 1:46070549-46070571 GGAAATGCAGAAGTTAAGCTGGG + Intronic
906779846 1:48563450-48563472 GAAAATGGAGAGAGGAAGAGAGG + Intronic
908413879 1:63893378-63893400 GGAAGTGCAGAGATAGAGACTGG + Intronic
908558764 1:65284298-65284320 AGAAAGGCAGAGATGGAGAAAGG - Intronic
908971209 1:69833880-69833902 GTAAATGCAAGGAGGAAGATAGG + Intronic
909452904 1:75818620-75818642 AGCAATGCAAAGATGACGATGGG - Intronic
909931895 1:81506043-81506065 GGAAATGCAGAGAACAAAATGGG + Intronic
910237868 1:85053602-85053624 GAAAATGCAGAAAACAAGATTGG - Intronic
911414526 1:97555234-97555256 GAAAATGAAGAGGTGAAGAGGGG - Intronic
911715060 1:101123521-101123543 GGAGATGCTGAGATGACGCTGGG - Intergenic
911787462 1:101968908-101968930 GGAAGTGCAGAGATTAAAAATGG + Intronic
911908047 1:103594623-103594645 GGGAATGCAGGCTTGAAGATGGG + Intergenic
911913581 1:103667104-103667126 GGGAATGCAGGCTTGAAGATGGG + Intronic
911914871 1:103684843-103684865 GGGAATGCAGGCTTGAAGATGGG - Intronic
911920998 1:103761251-103761273 GGGAATGCAGGCTTGAAGATGGG + Intergenic
912573114 1:110639121-110639143 GGAAATGCAGATTTGAAAAGAGG - Intergenic
912692117 1:111812330-111812352 GGAAATGCAAAAATGATGGTGGG + Intronic
912702917 1:111891604-111891626 GGTAAAGCAGAGAGGGAGATGGG - Intronic
914234134 1:145792767-145792789 GGATATGCAGACAGGCAGATAGG + Intronic
914235326 1:145804829-145804851 GGAAGTGGAGGGATGGAGATAGG + Intronic
914904739 1:151734621-151734643 GGAAATGGGGAGATGAATTTTGG + Intergenic
915937173 1:160096380-160096402 GCAAAACCAGAGAGGAAGATGGG + Intronic
915950622 1:160187730-160187752 AGAAATGCTGAGACGAAGGTGGG - Intergenic
916156838 1:161859241-161859263 CAATATGCAGAGATGAATATAGG - Intronic
919821776 1:201477552-201477574 GGGAATGCACAGAGGAAAATAGG + Intergenic
920342216 1:205282549-205282571 GGAAAGACAGAGATGAAAATAGG + Intergenic
920412085 1:205770164-205770186 GGAGATGCAGAAATGCACATGGG + Exonic
920966415 1:210705029-210705051 GGAAATGGGGAGAGGAAGGTAGG + Intronic
921590443 1:216996393-216996415 GGAAAAACAGAGAAGAAGATAGG + Intronic
921650521 1:217672915-217672937 GAAGATACAAAGATGAAGATAGG - Intronic
921783989 1:219204427-219204449 GGAAATGAAGAGTTCAAGACAGG - Intronic
922731936 1:227953033-227953055 AGAGAGACAGAGATGAAGATAGG + Intergenic
923029396 1:230235440-230235462 GGCAGTGGTGAGATGAAGATGGG - Intronic
923427031 1:233881269-233881291 CTAAATGCAGAGATGGAGGTGGG - Intergenic
1063042384 10:2356553-2356575 GGAACTGAAGAGATGAAACTGGG - Intergenic
1064754353 10:18560961-18560983 TGAAATGCAGTGATGGAGAATGG + Intronic
1064809690 10:19181557-19181579 GGAAATGGAGATATGTAGATCGG + Intronic
1065290353 10:24223409-24223431 GGCATTGCAGAGAGGAAGACAGG - Intronic
1065322657 10:24523646-24523668 TAAAATGGAGTGATGAAGATGGG - Intronic
1066305528 10:34136803-34136825 TGAAAGGAAGAGATGAACATGGG - Intronic
1066444572 10:35470105-35470127 GGAGATGGAGAGAGAAAGATAGG + Intronic
1066630131 10:37451055-37451077 GGAAATACTGATATGAAAATAGG - Intergenic
1067215841 10:44302087-44302109 AGAAATGAAGAGATGGGGATGGG - Intergenic
1067302907 10:45030822-45030844 GGAAATGCAGAAATGCAGGAGGG - Intergenic
1067510711 10:46892864-46892886 GGAAATTCATAGAAGCAGATTGG - Intergenic
1067651544 10:48158998-48159020 GGAAATTCATAGAAGCAGATTGG + Intronic
1068071223 10:52198772-52198794 GTAAAGACAGAGATAAAGATTGG - Intronic
1068216330 10:53987393-53987415 GCAAATGCAGAGCTTAAGAGTGG + Intronic
1068373916 10:56154730-56154752 GGAAAGGGAGGGATGAAGAATGG - Intergenic
1069225168 10:65934207-65934229 GGAAATAGAGAAATGAAAATGGG - Intronic
1069236345 10:66080194-66080216 AGAAATGCAGAGAAGAAAAGTGG - Intronic
1069616179 10:69807595-69807617 TGAAATGCTGGGATGAGGATGGG + Intronic
1070076061 10:73137318-73137340 AGAACTGCAGAGAGAAAGATTGG - Intronic
1070129370 10:73646483-73646505 GGAAATGCAGAGACAAAGAGAGG + Exonic
1070247748 10:74747922-74747944 GGAAGCACAGAGATGGAGATGGG + Intergenic
1070385912 10:75924517-75924539 GGATATACAGAGAGGATGATGGG + Intronic
1070557410 10:77539303-77539325 GATAATGCAGAGATGGAGATGGG + Intronic
1071073583 10:81725350-81725372 GGAGATGAAGAGAGGTAGATTGG - Intergenic
1072630125 10:97140007-97140029 GGAAAGACAGAGAGGAAGAGGGG - Intronic
1073666000 10:105534520-105534542 GGAAATGAAGAGAGGAAGTGGGG + Intergenic
1074305544 10:112274855-112274877 GGAAAGGCAGAGAAGAATTTGGG - Intergenic
1075494543 10:122908615-122908637 GGAACAGGAGAGATGAAAATAGG - Intergenic
1075527146 10:123196547-123196569 GGAAGAGCAGAGAGGAACATGGG - Intergenic
1075687066 10:124371576-124371598 GGAAAAGCAGAGAGGGTGATGGG + Intergenic
1076428593 10:130384905-130384927 GGAAATACAGAGAGGCAGAGGGG - Intergenic
1076765406 10:132630471-132630493 GGAAAGGCATACATGAAGAGAGG + Intronic
1077185264 11:1232935-1232957 GGGGATGCTGAGTTGAAGATGGG + Intronic
1078286002 11:9956759-9956781 GGAAATGTAGAGATAAAGGTGGG + Intronic
1078527120 11:12109977-12109999 GGCAGAGCAGAGATTAAGATAGG + Intronic
1078664229 11:13311200-13311222 GGAAATGCAGGGCTGAAGCCTGG + Intronic
1079072780 11:17362829-17362851 GGAAATGAAGAAATGAAGAAAGG - Intronic
1079097059 11:17517777-17517799 GGAAGTGCAGTGAGGAGGATGGG + Intronic
1079384446 11:19966465-19966487 GGAAATGAAGAAATGAGGCTAGG - Intronic
1079810301 11:24990539-24990561 GTAAATGCAGAGATGAAGACTGG + Intronic
1080399844 11:31923519-31923541 GGAAGAGGAGAGATGAAGAAAGG + Intronic
1082232928 11:49791272-49791294 GCAAATCCAGAGATGTAGATGGG + Intergenic
1082270710 11:50166801-50166823 GGCAATGCAGAGGGGAAGTTTGG + Intergenic
1082944006 11:58739270-58739292 GGACAGGCAGAGATGAACAGGGG + Intergenic
1084330733 11:68428541-68428563 GGAGATGGACACATGAAGATGGG - Intronic
1086218891 11:84417686-84417708 AGAAATGAAGAGCTGAGGATAGG - Intronic
1086399428 11:86448389-86448411 GGAAATGTAGTCAAGAAGATGGG - Intronic
1086451146 11:86918216-86918238 GTAAATGCAGAGATGAAGCTTGG + Intronic
1086617700 11:88842643-88842665 GCAAATCCAGAGATGTTGATGGG - Intronic
1086948831 11:92870538-92870560 GGAAATGCAGGGATCACAATGGG - Intronic
1087020667 11:93599667-93599689 GCAAATGCTGAGATGAACTTAGG + Intergenic
1088318579 11:108531879-108531901 GGAGATGTAGAGATGTGGATGGG - Intronic
1089221187 11:116873376-116873398 GGAAATTCAGACATGTAGGTTGG + Intronic
1089352132 11:117827873-117827895 GGAAAAGCAGAAAGGAAGAGAGG - Intronic
1089794551 11:120969760-120969782 GGAAATGGAGAGGTGAACCTGGG + Intronic
1090638595 11:128710241-128710263 AAAAATGAAGAGATGAAGAAAGG + Intronic
1090691872 11:129192004-129192026 CGAAATGCAGAGAAGAAAAAGGG + Intronic
1090865021 11:130692193-130692215 GGCAATGGAGAGATGATCATTGG - Intronic
1091812398 12:3410367-3410389 GGAATTGCAGAGAGGAAGCTGGG - Intronic
1092915898 12:13188721-13188743 GAAATTGCAGATATGAGGATTGG - Intergenic
1092952996 12:13525429-13525451 GGAAATGGAGGGATGGAAATGGG + Intergenic
1093242284 12:16691959-16691981 GGAAAGGAAGAGATGAACCTCGG + Intergenic
1093452756 12:19334472-19334494 GGAAATGCAGAGTTCAGGGTAGG - Intronic
1093706430 12:22279614-22279636 CAGAATGCAGAGATGAAAATGGG - Intronic
1093950667 12:25162688-25162710 GGAAAGGAAGAAATGAAGGTGGG - Intronic
1093956437 12:25224911-25224933 GGAAATGAATACATAAAGATAGG - Intronic
1094187700 12:27662849-27662871 AGAAATGCAGAGTTGTAGATTGG + Intronic
1094819093 12:34211142-34211164 GGACAGGCAGAGATGGAGAGAGG - Intergenic
1095325195 12:40882019-40882041 GGGAAGGAAGAGATGAAGATAGG + Intronic
1095355001 12:41262057-41262079 GGCAATGGAAGGATGAAGATTGG - Intronic
1095940434 12:47723525-47723547 GGAAAGGCTCAGATGAAGAAAGG - Intronic
1097827314 12:64187373-64187395 GAAAATGGAGAGATGCAAATGGG - Intronic
1098150092 12:67537766-67537788 GGAAATGCAGTGGTGAACACGGG - Intergenic
1098505542 12:71246106-71246128 GGAAATCCAGAAATAAAGACTGG - Intronic
1098821746 12:75239794-75239816 TTAAATGCAGAGATGAAGATAGG - Intergenic
1099359199 12:81678155-81678177 GGAAAGACAGGGATGAAGAGGGG + Intronic
1099855166 12:88155566-88155588 GGAAATGCAGGTATAAAGGTGGG - Intronic
1101134433 12:101726438-101726460 GGAAAAGAGGAGATGAAGTTAGG + Intronic
1101140507 12:101790859-101790881 GGAAAAGCAGAGGTGAGGCTGGG - Intronic
1101584408 12:106072431-106072453 TGAAATGCAGAGATCTACATTGG + Intronic
1101634659 12:106528593-106528615 AGAAATGCAAAGATGGAGGTGGG + Intronic
1101689763 12:107066340-107066362 GGATATAGAGAAATGAAGATGGG - Intronic
1101698478 12:107149456-107149478 GTAAATGCTGAGATGGAGAAGGG - Intergenic
1102005540 12:109587143-109587165 AGGAATGGAGAGATGAAGCTTGG + Intronic
1106143075 13:27027218-27027240 GGAAATGCAGAGAAGAAATGTGG + Intergenic
1106503160 13:30348439-30348461 AGAAAAGCAGAGATTATGATGGG - Intergenic
1106528163 13:30561870-30561892 GGAAATGCAGACATGAGGGAGGG + Intronic
1107249122 13:38336534-38336556 AACAATGCAGAGATTAAGATAGG - Intergenic
1107636786 13:42400270-42400292 TGAGATGTAGAGATGAAGAAGGG + Intergenic
1107966194 13:45600313-45600335 GGAAGTGCACAGATGAATCTGGG - Intronic
1108602517 13:52006961-52006983 GGGGATGCATAGATGAAGAGAGG - Intronic
1108975385 13:56437215-56437237 GAAAATGGAGAGATGTAGTTTGG + Intergenic
1109021744 13:57104665-57104687 AGAAAGGGAGAGATGAAGAAAGG + Intergenic
1110195320 13:72781959-72781981 GAAAATGCCGAGATAAACATTGG + Intronic
1110759340 13:79213803-79213825 GGAAAGGCTGAGATGAAGCTCGG - Intergenic
1111149492 13:84231391-84231413 GGAATTACAGAGATGAAAGTGGG - Intergenic
1112074112 13:95889909-95889931 AGAAGTGCAGAGATGATGTTAGG + Intronic
1112174780 13:97011274-97011296 AGAAATGCAGAAATGATTATAGG - Intergenic
1113136416 13:107095423-107095445 GAAAAAGAAGAGATGAAGAAGGG - Intergenic
1116713919 14:48404759-48404781 GGAGACGAAGAGATGAAGAGAGG - Intergenic
1117490160 14:56239192-56239214 GAAAATGCAGAGAGCAAGACAGG - Intronic
1118157399 14:63255314-63255336 GGAAATGCAGAGAGGCAACTGGG - Intronic
1118939037 14:70315703-70315725 GGAAAGGGAGAAATGAAGCTTGG + Intergenic
1119042429 14:71287078-71287100 GAGAATGCAGAGATGTTGATAGG - Intergenic
1119145883 14:72313643-72313665 GGAAATACAGACATAGAGATGGG - Intronic
1120249884 14:82050312-82050334 TTAAATGCAGAGTGGAAGATGGG + Intergenic
1120555385 14:85923801-85923823 GGAAAAACAGAGCTGAAGAGGGG + Intergenic
1121181931 14:91935506-91935528 GAAAATGCAGAGATAGAGGTGGG - Intronic
1122005557 14:98700590-98700612 TGAAATGCAGAGATGGAGGAAGG + Intergenic
1122758420 14:104001261-104001283 GAAGCTGCAGAGATGAAGACGGG - Intronic
1123489784 15:20771790-20771812 GGTAAAGCAGAGATGAGGAAAGG + Intergenic
1123546283 15:21340877-21340899 GGTAAAGCAGAGATGAGGAAAGG + Intergenic
1123768945 15:23509931-23509953 GGAAGTGCAGGATTGAAGATAGG + Intergenic
1125018957 15:34966387-34966409 TGAAATGCAGAGAGGAAAGTGGG - Intronic
1125024444 15:35016633-35016655 GAAGAGGCAGAAATGAAGATGGG + Intergenic
1125026217 15:35032004-35032026 GGAAATGAAGAGAAGAATTTTGG + Intergenic
1125840439 15:42796068-42796090 GGAAATGCAGATATAAATTTGGG + Intronic
1125935881 15:43635285-43635307 GGAAAACTAAAGATGAAGATTGG - Intronic
1125948647 15:43731742-43731764 GGAAAACTAAAGATGAAGATTGG - Intergenic
1126111868 15:45179902-45179924 AGCAAGGCAGAGATGAAGAAAGG + Intronic
1126210392 15:46094746-46094768 GGAAACACTGAGATGAAGTTTGG + Intergenic
1126705679 15:51402848-51402870 GGAGGTGTAGAGATGATGATGGG - Intronic
1127639189 15:60899385-60899407 TGAAATGCATAGATGTGGATAGG + Intronic
1127655891 15:61055321-61055343 GGAACTGCTGCGATGAAGAGTGG - Intronic
1127825217 15:62696907-62696929 GGAAATGTGGAAATGAAGCTAGG - Intronic
1130805572 15:87317980-87318002 GGAAAAGAAGAGATGCAGAGTGG - Intergenic
1130889653 15:88122749-88122771 GGAAGTAGAGAGATGATGATAGG - Intronic
1131305115 15:91235885-91235907 GGAGATGCAGAGATAGAGAGGGG + Intronic
1131767336 15:95692693-95692715 GGAAATACTGAGAAGAAGAGAGG + Intergenic
1132142209 15:99405426-99405448 GGAAATGCAAAGATGAGCCTAGG + Intergenic
1202954610 15_KI270727v1_random:68092-68114 GGTAAAGCAGAGATGAGGAAAGG + Intergenic
1133868456 16:9665965-9665987 GGATATGCAGAGCTGAAGCTTGG - Intergenic
1134173103 16:11984598-11984620 GGAGAGGGAGAGAGGAAGATAGG - Intronic
1134690867 16:16190380-16190402 GGAAAAAGAGAGATGAAGACAGG + Intronic
1135842381 16:25888361-25888383 AGAAACGCAGAGATAAAGAGAGG - Intronic
1135882682 16:26274112-26274134 GAGAATGGAGAGAAGAAGATGGG - Intergenic
1137608599 16:49803837-49803859 GGAAAGGCAGAGCTCAAGGTGGG + Intronic
1138472869 16:57252076-57252098 GGGAAGGCAGAGCTGAAGGTGGG - Intronic
1138761597 16:59550425-59550447 GGAAATGCACAGATGAGCCTAGG + Intergenic
1139223037 16:65204185-65204207 GGAAATGAAGAGGTGAAGGACGG + Intergenic
1139290976 16:65857569-65857591 AAAAATTCAGTGATGAAGATAGG - Intergenic
1139431002 16:66911045-66911067 GGAGAGGCAGATATGAAGCTGGG - Intronic
1139743450 16:69055283-69055305 GGAAAAGCAGAGATAGAGCTGGG + Intronic
1140159566 16:72473996-72474018 GGAACTGAAGAAATGAAGAAAGG + Intergenic
1140357370 16:74318132-74318154 GGAGGTGCAGAGCTGAAAATCGG - Intergenic
1140901776 16:79374404-79374426 ACAAAAGCAGAGATGAAGCTTGG - Intergenic
1141005742 16:80349957-80349979 GGACATGCAGAGATGAAGAAAGG - Intergenic
1141157884 16:81609805-81609827 GGAGATGGAGAGATGGAGTTTGG + Intronic
1141393595 16:83685040-83685062 TGGAATGCAGATATGAAGGTTGG - Intronic
1141472504 16:84248744-84248766 GGAAAGGCAGAGATCAAGGTTGG + Intergenic
1142694390 17:1625490-1625512 TGAATTGCAGAGAAGCAGATAGG - Intronic
1143251099 17:5523678-5523700 GGCAATGCAGGGATGGAGCTGGG - Intronic
1143595289 17:7910362-7910384 GGAAATACAGAGATGGAGCCAGG - Intronic
1144183251 17:12772043-12772065 GGAAATGGAGAGACAAAGGTAGG + Intergenic
1144362735 17:14510543-14510565 GGAAATGCTGAGATGAAACCAGG - Intergenic
1144770731 17:17758015-17758037 GGAAAGGGAGAGATGAGGGTGGG - Intronic
1144786979 17:17837313-17837335 GGAAATGAGGAAATGAAGTTTGG - Intergenic
1145415715 17:22712136-22712158 GAAAAGGCAGAGTTGAAGCTGGG - Intergenic
1146027215 17:29331908-29331930 GGAAATGGAGAGAAGGAGAGAGG - Intergenic
1146504951 17:33396775-33396797 GGAACTTCAGTGATGGAGATAGG + Intronic
1147608765 17:41789097-41789119 GGTAAGGCAGGGATAAAGATAGG - Intergenic
1148212688 17:45817828-45817850 GGAAGTGCAGAAAGGAAGAAGGG + Intronic
1149574029 17:57698442-57698464 GGAAAGGCAGAAGTGAAGACAGG - Intergenic
1150188407 17:63211564-63211586 GGAAGTGCAGAGCTGAGGAAAGG - Intronic
1150432681 17:65131027-65131049 GGAAGTGCAGAGATAAAGGTTGG + Intergenic
1150466716 17:65399504-65399526 GGAAATTCATTGACGAAGATGGG - Intergenic
1150505322 17:65692784-65692806 GGGCTTGCAGAGATGAAGAGAGG - Intronic
1150652937 17:67021684-67021706 GGAAATGCAGACTTGGAGAGGGG - Intronic
1153045649 18:853532-853554 AGAAGTGCAGAGATGAATTTCGG - Intergenic
1153299823 18:3582879-3582901 GGAAAAGCAGGGAGGAAGAAAGG - Intronic
1154082083 18:11267499-11267521 GGAAATACAGAAGAGAAGATGGG + Intergenic
1155178800 18:23325147-23325169 TGAAATCCAGAGATGGGGATGGG - Intronic
1155242750 18:23879110-23879132 GCAACTGCAGAGGGGAAGATGGG - Intronic
1155649332 18:28121569-28121591 GGACATCCAGAGCTGGAGATTGG - Intronic
1155718479 18:28977768-28977790 GGAAATGAAGAGAGGTAGAAGGG + Intergenic
1155884199 18:31187299-31187321 GGGAAATCAGAGATGAAGAGGGG + Intergenic
1156917266 18:42476462-42476484 GAAAATGTAAGGATGAAGATGGG + Intergenic
1156934659 18:42689198-42689220 AAATATGCAGAGTTGAAGATGGG + Intergenic
1157398065 18:47360213-47360235 GGAAATGGGGGGATGAAGAGAGG - Intergenic
1157952229 18:52052589-52052611 TCAAGTGCAGAGATGAAGGTAGG + Intergenic
1158298963 18:56031302-56031324 TGGAATGCAGAGAAGAAGAAAGG + Intergenic
1159229683 18:65590379-65590401 GGAAAAGCAAAGATGAAGAAAGG + Intergenic
1160406385 18:78649318-78649340 GGAGCTGCAGAGATGCGGATAGG + Intergenic
1161256193 19:3311132-3311154 GGAGATGGAGAGATGGAGACAGG - Intergenic
1161256207 19:3311254-3311276 GGAGATGGAGAGATGGAGACAGG - Intergenic
1161282271 19:3452501-3452523 GGAAATGCAGAGCGGAGGACGGG - Exonic
1161458430 19:4381639-4381661 GGAAATGAAGAGAGGCAGAGGGG - Intronic
1161984446 19:7645913-7645935 GGAAACAGAGAGAGGAAGATGGG - Intronic
1162097172 19:8317130-8317152 GGAAATGCAGAGATCTTGACAGG - Intronic
1162821416 19:13225655-13225677 GGAAACACAGAGTTGAAGATGGG + Intronic
1165042046 19:33075532-33075554 GAAACTGCAGATAGGAAGATGGG - Intergenic
1165311471 19:35031230-35031252 GGACAGGGAGAGATGAAGACGGG + Intronic
1166175518 19:41066163-41066185 GGAGATGCAGAAAAGAAGTTGGG - Intergenic
1168309770 19:55454583-55454605 GGAGATGGAGAGTTGGAGATGGG + Intronic
925539401 2:4950712-4950734 CGAAAGCCAGAAATGAAGATGGG + Intergenic
926067420 2:9854465-9854487 TGAGATGTAGAGATGAAGATGGG + Intronic
926777300 2:16435113-16435135 GGGAATGCAGAGATCAATAAGGG + Intergenic
927992593 2:27458603-27458625 GGAAAGGAAGGGATGAAGAGAGG - Intronic
928392996 2:30923565-30923587 GGAGATGCAGAGGTGAAGCTGGG + Intronic
929214832 2:39401229-39401251 TGAAATTTTGAGATGAAGATGGG - Intronic
929345183 2:40873747-40873769 GGAAAACAAGAGATGAAGTTTGG - Intergenic
929722971 2:44389788-44389810 GGAATAGCAGACCTGAAGATTGG + Intronic
930006233 2:46899267-46899289 GAGAATGCAGATCTGAAGATGGG + Intergenic
930379674 2:50612185-50612207 GCAAATGAAGACATGGAGATAGG - Intronic
931633988 2:64325845-64325867 GGACATGCAGAGATGAGAACGGG + Intergenic
931788979 2:65646603-65646625 GGATGAGCAGAGATTAAGATAGG - Intergenic
931792564 2:65677765-65677787 GCAAAAGCAGTGATGAATATTGG + Intergenic
931953460 2:67391484-67391506 GGAACTGCAGAGGTCATGATGGG - Intergenic
932036594 2:68252395-68252417 GGAGAGGCAGAGAAGAAGAAAGG + Exonic
932409591 2:71537673-71537695 GGAAATACAAAGAGGAAGAAAGG + Intronic
932538655 2:72627230-72627252 TGAGAAGCAGAGATGAAGAGAGG - Intronic
932791137 2:74655004-74655026 GGAAATGCTGACCTGGAGATCGG - Intronic
933041957 2:77480253-77480275 GGAACTACAGAGAAGAAGACTGG + Intronic
935109982 2:100083729-100083751 AGAAATGCAGAGACGATGAGAGG + Intronic
936124998 2:109781479-109781501 AGAAATGCAGAGACGATGAGAGG - Intergenic
936152133 2:110027708-110027730 GGAAGTGCAGAGATGGACAGGGG + Intergenic
936192545 2:110343705-110343727 GGAAGTGCAGAGATGGACAGGGG - Intergenic
936219695 2:110589989-110590011 AGAAATGCAGAGACGATGAGAGG + Intergenic
936959650 2:118059470-118059492 GGAACTTCAGACATGAAAATTGG + Intergenic
936973851 2:118200093-118200115 GGGAATGCAGGGGTGAAGAGAGG - Intergenic
936983649 2:118287753-118287775 GGAAAAGTAGAGAAGTAGATGGG + Intergenic
938250365 2:129811120-129811142 GAAAAACCAGAGATGAAGTTAGG - Intergenic
939129472 2:138217141-138217163 GGGTCTGCAGAGATGAAGAGGGG + Intergenic
939382225 2:141450116-141450138 GGAGATACAGAGAAGAAGAGAGG + Intronic
939959470 2:148553653-148553675 GGCTATGCAGAGAAAAAGATGGG + Intergenic
940892673 2:159049811-159049833 GGAAGTGGGGAGAGGAAGATGGG + Intronic
941066058 2:160904173-160904195 GGAGATGGAGAGGTGAAGGTAGG + Intergenic
941200166 2:162498547-162498569 CCCATTGCAGAGATGAAGATAGG - Intronic
941838757 2:170055529-170055551 TTAAATGCAGCGAAGAAGATAGG + Exonic
942064932 2:172261756-172261778 GTTAATGCAGAGATGATGTTTGG - Intergenic
942511223 2:176704210-176704232 GGAAATGCAGAAAGGCAGAAGGG - Intergenic
943490611 2:188550925-188550947 TGAAATGGAGACATGAAAATTGG - Intronic
944151407 2:196562583-196562605 GGAAATGCAGTGATAAGGCTGGG - Intronic
944230963 2:197392420-197392442 GGAAAGTCAGAGATGTATATTGG - Exonic
945494735 2:210496350-210496372 GGAAATGCTGATAACAAGATGGG - Intronic
945555669 2:211272284-211272306 GGACATGCAGAAAGGAAGAATGG - Intergenic
945586611 2:211672768-211672790 GGAAATTGAGACATCAAGATAGG - Intronic
946818393 2:223604839-223604861 GGAAATACAGAAATAAATATGGG + Intergenic
946906066 2:224417578-224417600 GGAACTGCAGCTTTGAAGATAGG + Intergenic
947982420 2:234421708-234421730 GCACATGCAGAAGTGAAGATAGG + Intergenic
948491138 2:238314113-238314135 AGAAGTGCAGAGCTGCAGATGGG - Intergenic
1169683314 20:8241910-8241932 GTAAAGGCACAGATGAAGACAGG + Intronic
1169894106 20:10484075-10484097 GGAAATGAAGATCTGAATATAGG - Intronic
1170130409 20:13012959-13012981 GGAACTCCAGAGATGAATGTAGG + Intronic
1170878434 20:20272791-20272813 GGAAATGGAGAGAGAAAGAAAGG - Intronic
1172264686 20:33600787-33600809 GGAAGTTCAGAGATGAAGGTAGG - Intronic
1172448615 20:35006239-35006261 GGGAATGCAGGGATGAAAACCGG - Intronic
1172492921 20:35355519-35355541 GGAAAAGCAGAGCTGAAGGCTGG + Intronic
1172788407 20:37485839-37485861 GAAGATGTAGAGAGGAAGATGGG + Intergenic
1172961628 20:38804663-38804685 GGAAATTCAGAGTTTAAGTTTGG - Intergenic
1173065492 20:39706613-39706635 GGCCATGCAGTGATGAAGTTTGG + Intergenic
1173078223 20:39841250-39841272 GTAACTAGAGAGATGAAGATAGG + Intergenic
1174104359 20:48151755-48151777 GTAAATGCTGAGACTAAGATTGG - Intergenic
1174124891 20:48297144-48297166 CGAGGTGCAGAGATGGAGATGGG - Intergenic
1174830923 20:53811574-53811596 GGAGATGGAGAGAAGAAGCTAGG + Intergenic
1175548262 20:59794888-59794910 GGAAAATCAGAGATGAAAAATGG - Intronic
1175551928 20:59822917-59822939 GGAAGCCCAGAGATGGAGATGGG + Intronic
1175790336 20:61736690-61736712 GGATATGCACAGCTGAAGAAGGG - Intronic
1176972709 21:15285418-15285440 GTAAATCCAGAAATGAAGCTGGG - Intergenic
1177758522 21:25375431-25375453 GGAAATGGGGAGATGAAGAGAGG - Intergenic
1177882954 21:26715973-26715995 GAAATTGCAGAGATGAAGGAGGG + Intergenic
1178178911 21:30136838-30136860 GGAAATGAAGAAATAAAGCTAGG - Intergenic
1178382492 21:32122328-32122350 GGAAAGGGAGAGAGAAAGATGGG + Intergenic
1178477561 21:32950653-32950675 GAAAATGCACAAATGAAGAAGGG - Intergenic
1178901297 21:36601178-36601200 GGACATGCAGGGATGGAGCTGGG - Intergenic
1180753628 22:18144505-18144527 CAAAATGCAGAGAAGAAAATAGG + Intronic
1181443168 22:22949102-22949124 GCCAATGCGGAGATGAAGACAGG - Intergenic
1181673858 22:24439396-24439418 GGCAATGCAGAGATGGATGTAGG + Intronic
1181960304 22:26617829-26617851 GGAAGTGGAGAGAGGAAGAAAGG - Intronic
1182156562 22:28078986-28079008 GGAAATGCTAAGCTGAAGAAGGG + Intronic
1183232938 22:36594128-36594150 GGAAAGTCAGAGATGGAGAGAGG - Intronic
1183238293 22:36636875-36636897 TGTAATGCAGAGAAGAAGCTGGG + Intronic
1183317527 22:37145135-37145157 GGAAAAGCAGAAAAGCAGATAGG + Intronic
1183318699 22:37150742-37150764 GGAAGGGCAGTGATGGAGATGGG - Intronic
1185187565 22:49411397-49411419 GGAAATGCAAAGACCAAGAAGGG - Intergenic
949133901 3:538762-538784 GGAAGTGTATAAATGAAGATTGG + Intergenic
949578011 3:5357788-5357810 GGCATTGCAGAGATGAAGGCAGG - Intergenic
949615074 3:5744691-5744713 ACAAATACAGATATGAAGATAGG - Intergenic
949697530 3:6716455-6716477 GGAAATGCTGAGGAGAAGAAAGG + Intergenic
950666406 3:14497933-14497955 GGAAATCCAGAGATGGAGGTGGG + Intronic
950916640 3:16652585-16652607 GGAAATGAAGATATGAAGAAAGG + Intronic
952564947 3:34644058-34644080 GGAAATAAAGAGATGCAAATTGG + Intergenic
952944277 3:38466876-38466898 GGAATGTCAGAGATGAAGAGAGG + Intronic
953478219 3:43224660-43224682 GGAAATGGGGAGATGAAAGTAGG - Intergenic
954628588 3:52036151-52036173 GGAAATGCTGCCTTGAAGATGGG - Intergenic
955362007 3:58283697-58283719 GTTAATGCAGAGATGGAGGTTGG + Intronic
956177202 3:66484171-66484193 GGAAATACACAGATGAAGCCTGG + Intronic
956449531 3:69359660-69359682 GGAAAAACAGAGATGAAAAGAGG + Intronic
956574424 3:70736098-70736120 GGGAATACAGACATGAAGAAAGG + Intergenic
956846026 3:73183688-73183710 GGGGGTGCAGAGATGGAGATAGG - Intergenic
958642290 3:96820445-96820467 GGAGCTGGAGAGAAGAAGATGGG + Intronic
960273180 3:115696755-115696777 GGAAATGCTGGGATGAGGTTGGG - Intronic
961012693 3:123447131-123447153 GGGAATGCAGTGAGGAAGGTTGG - Intronic
961066831 3:123883482-123883504 GGCATTGCAGATGTGAAGATGGG - Intronic
961185558 3:124912211-124912233 GGAAAGGAAGAGGTGGAGATTGG - Intronic
961235988 3:125368107-125368129 GGGAATGGAGAAATGAACATTGG - Intronic
962159451 3:132983555-132983577 AGAAATACGGAGATGAAGATAGG - Intergenic
963278801 3:143360310-143360332 AGAAATGCAGAGATGAGAAATGG - Intronic
963486443 3:145939899-145939921 GACAATGCAGAGTTGAAGAGAGG + Intergenic
963899670 3:150721995-150722017 GGGGATGCAAAGGTGAAGATGGG - Intergenic
964155232 3:153577035-153577057 AGAAAAGCAGAGGTGAAGCTGGG - Intergenic
964343082 3:155729252-155729274 GGACAGGCAAAGATGAAAATTGG - Intronic
964417735 3:156465838-156465860 GGGAATGCAGAGATGTAGAGGGG + Intronic
964574602 3:158151196-158151218 GGAAATGAAGACATGAAGAAAGG + Intronic
964805870 3:160609123-160609145 GGAAATGCAGAGCTAAAAAGAGG - Intergenic
964928709 3:161988935-161988957 GTAAATACAGAGGTAAAGATTGG - Intergenic
966193763 3:177294176-177294198 GGAAGAGCAGAGATGCAGCTGGG + Intergenic
966319392 3:178684350-178684372 GGAAATGGGGAGATGTAGATTGG + Intronic
966470408 3:180282649-180282671 GCAGATGCTGAGATGGAGATAGG - Intergenic
966839461 3:184076855-184076877 GGACAAGCACAGAGGAAGATGGG + Intergenic
967108723 3:186274043-186274065 GAAAAAGCAGAGAGGAAGACTGG - Intronic
970051035 4:11915508-11915530 GAAAATTGAGAGATGAAGATTGG + Intergenic
970118272 4:12723625-12723647 GAAAATGCAGAGAATGAGATGGG - Intergenic
970166997 4:13249170-13249192 GGAAATGAAGGGATGAGAATAGG + Intergenic
970281645 4:14463184-14463206 TGAAATGAAGAGATGAAAAAAGG - Intergenic
970398878 4:15699040-15699062 GAAATTTCAGAGATGAAGTTGGG - Intronic
970840044 4:20457809-20457831 GGAAGTGCAGAAAGTAAGATGGG + Intronic
971693317 4:29866042-29866064 GGAAATGGAGAGTTGGAGGTGGG + Intergenic
973550919 4:52035431-52035453 GGAAATGGGGAGAAGTAGATGGG + Intronic
973691704 4:53440731-53440753 GCAAAGGCAGAGCTGAAAATAGG - Intronic
973867222 4:55125737-55125759 GGAAATGGGGAGATGTAAATGGG - Intergenic
974915135 4:68170291-68170313 GGAAGGGGAGAGATGAAGAGAGG - Intergenic
975117048 4:70691438-70691460 AGAGATGCAGAGATGACGCTTGG + Intergenic
975749392 4:77507443-77507465 GTAAATGCAGAAATGAAGTGTGG + Intergenic
976448374 4:85158622-85158644 GGAAATACAGACATGATGACAGG - Intergenic
977064689 4:92299841-92299863 AGAAAGGGAGAGATGAAGAGAGG + Intronic
977081705 4:92537967-92537989 GGAAATGGCAACATGAAGATTGG - Intronic
977171598 4:93768954-93768976 AGAAAAGGAGAGAGGAAGATGGG + Intronic
977298647 4:95241193-95241215 AGAAATGCATAAATGAAAATCGG - Intronic
977993679 4:103476422-103476444 GGAAGTGCACAGATGAACCTAGG + Intergenic
978100708 4:104837482-104837504 GAAAATGCTCAGAAGAAGATGGG + Intergenic
978171328 4:105673706-105673728 AGAAAGGAAGAGAGGAAGATGGG + Intronic
978277363 4:106968000-106968022 GGAGATGGAGAGATGAAGGCAGG + Intronic
979227619 4:118306896-118306918 GGAAATACAAAGGGGAAGATTGG - Intronic
980188943 4:129497988-129498010 GGAAATGCTGACATGGAAATAGG - Intergenic
980687346 4:136245228-136245250 GGCTATGCAGAAATGAACATAGG - Intergenic
981819493 4:148869291-148869313 GGAAAGGCAGAGGTGAGGAGAGG + Intergenic
982408904 4:155050457-155050479 TGAATTGAAGATATGAAGATAGG + Intergenic
982792003 4:159603637-159603659 GGAGATGTATAGAAGAAGATTGG + Intergenic
983247459 4:165304480-165304502 GGAAAAGAAGAGATAATGATTGG - Intronic
983915522 4:173287465-173287487 GGTAGTGCAGACTTGAAGATGGG + Intronic
984329691 4:178298574-178298596 GTAGATGCAGAGATGAAGTGTGG - Intergenic
984887556 4:184464168-184464190 GGATAGGAAGATATGAAGATAGG + Intronic
985002015 4:185494797-185494819 GGAAATGTAGACATGCAGAAGGG + Intergenic
985724278 5:1507561-1507583 GGAAATGCAGAGATGAAGATGGG + Intronic
985854568 5:2414896-2414918 GGAAATCCAGAGCTGAAGATGGG - Intergenic
985913442 5:2900480-2900502 GGAGCTGCAGAGAAGAAGCTGGG - Intergenic
986240680 5:5957050-5957072 TGTAATGCAGAGATGAAGAAAGG + Intergenic
986292975 5:6415200-6415222 GAAGATGCAGAGATGCAGAGGGG - Intergenic
989817218 5:45750914-45750936 AGAAATGCAGAGAAAAATATGGG - Intergenic
989969687 5:50508019-50508041 GTAAATGCTGACATAAAGATGGG + Intergenic
990040459 5:51372914-51372936 GGAAAGGCAGAGATTAAAAAGGG - Intergenic
990132701 5:52607091-52607113 GAAAATTCAGAGATGAAAAGAGG - Intergenic
990157204 5:52890858-52890880 GGAAGAGCAGGGATGAAGAGGGG - Intronic
990380105 5:55214509-55214531 TGAGATGCAGAGATGAAGAAGGG + Intergenic
990475730 5:56160115-56160137 GGGAGTGCTGAGATGAAGAGAGG - Intronic
990519604 5:56566134-56566156 GGAAATGCATAGTTTAATATTGG + Intronic
991958161 5:72016216-72016238 GGAAATGCAGAGATCCACAGAGG - Intergenic
992022117 5:72634990-72635012 AGAGATGAGGAGATGAAGATTGG - Intergenic
992296277 5:75330104-75330126 CGAAATGCAGATATGAAGGTTGG + Intergenic
992371761 5:76151167-76151189 GGACTTGCAGAGATGGAGCTGGG + Intronic
993622371 5:90183828-90183850 GAAAATGTAGAGATGTAGATTGG - Intergenic
994590999 5:101771401-101771423 AGAAACCCAGATATGAAGATAGG + Intergenic
994865798 5:105268103-105268125 GGAAGTGCACAGATGAACGTTGG - Intergenic
995382664 5:111551994-111552016 GGGAATGCAGAGAAGACAATGGG - Intergenic
996055711 5:118980027-118980049 GAAAATGAAGAAATGAACATTGG - Intronic
996421449 5:123267391-123267413 GGAAAAGCAAAGTTGAAGATGGG - Intergenic
996642580 5:125774801-125774823 GGAAATGCAGAGATAAGGCAAGG - Intergenic
996876898 5:128250341-128250363 GTGAAGGAAGAGATGAAGATTGG + Intergenic
997870397 5:137500956-137500978 GGGAGTGCAGAGATGCAGGTGGG - Intronic
998043516 5:138968489-138968511 GGAACTGGCCAGATGAAGATGGG - Intronic
998349871 5:141493575-141493597 GGAAATGCAGTGATTGTGATAGG - Intronic
998390563 5:141784560-141784582 GGAAAGGCAGAGAGGAGGAGCGG - Intergenic
998394758 5:141811593-141811615 GGAAAGGGAGAGATGGAGATGGG - Intergenic
998852628 5:146365232-146365254 GGAGATGCAGAGCAGGAGATGGG - Intergenic
999412709 5:151366362-151366384 GGAAATGTTGAGTTGAAAATTGG + Intergenic
1000035804 5:157447127-157447149 GGAAATGCAGACCTTGAGATAGG + Intronic
1000067223 5:157705077-157705099 GGAAATGCAGGGATGGAAACAGG - Intergenic
1000272095 5:159695919-159695941 GGGAATGCAGATATGCAGAGCGG + Intergenic
1000302400 5:159968052-159968074 GGGAATGCAGAGATGAGTTTGGG - Intronic
1001160039 5:169304611-169304633 GGAGAACCAGAGATGAAGAGGGG - Intergenic
1001633376 5:173192913-173192935 GGAAATCCAGAGCTCCAGATGGG + Intergenic
1002847781 6:963315-963337 GGAAAAGGAGAGAGGAAGACTGG + Intergenic
1003453489 6:6259776-6259798 GGAAAAGCAGTGATGGAGAATGG + Intronic
1003525270 6:6891831-6891853 GGGAAAGCAGAGATAAAGATGGG + Intergenic
1003700052 6:8453762-8453784 GGAAATCCAGAGATCTAAATTGG + Intergenic
1003955175 6:11156556-11156578 GGAAATCCAGAGATGTAGGAAGG + Intergenic
1003957170 6:11174622-11174644 GGAGATGGGGAGATGCAGATAGG - Intergenic
1004184523 6:13410645-13410667 GGAAAGGAAGAGAGGAAGAAAGG + Intronic
1004889503 6:20086194-20086216 AGATATGCAGAGTTGAAGTTGGG + Intergenic
1005154077 6:22783708-22783730 GGAACTGAAGAGTTGAAGAGCGG - Intergenic
1005737110 6:28758037-28758059 GGAAAGGCTGAGAAGAAGAAAGG - Intergenic
1005995393 6:30927939-30927961 GGAAATGCAGACACGGTGATGGG - Intergenic
1006423298 6:33948837-33948859 GGAAAGGCAAAGATGAGTATGGG + Intergenic
1007199100 6:40090288-40090310 AGAAATGCAAAGATGAATATGGG + Intergenic
1007269896 6:40628495-40628517 TGAAATGGATAGATGAAGAAGGG + Intergenic
1008317103 6:50058155-50058177 TTAAATGCAGAGATGTAGATGGG + Intergenic
1008348573 6:50460106-50460128 GTAAATGAAGAGATAAAGAGGGG + Intergenic
1008395446 6:51001257-51001279 GGAAATGCAGTGATAAAGACCGG - Intergenic
1010065848 6:71681620-71681642 GCAATAGCAGAGATGAAGAGTGG - Intergenic
1010804701 6:80221587-80221609 AGAAAAGAAGAGATGAAAATAGG - Intronic
1010917484 6:81638417-81638439 GGAAATGCGCAGATGAACTTAGG - Intronic
1011152295 6:84287833-84287855 GGAAGTGCTGTGATGGAGATGGG - Intergenic
1011923206 6:92608189-92608211 GGAAAGGCAGAGATGGTTATGGG + Intergenic
1012473417 6:99595612-99595634 TGAAATGCAGACATGATGGTTGG - Intergenic
1012556462 6:100518931-100518953 GGAAATGAGGATATGAAGACAGG + Intronic
1013241721 6:108252562-108252584 GGAAATGCAGATATTTAAATAGG - Intronic
1013431111 6:110055463-110055485 GCAAATGCAGAGAGGAAGAGAGG - Intergenic
1013909523 6:115257228-115257250 GGAACAGCAGTGATGAAAATGGG - Intergenic
1014618554 6:123636143-123636165 GGAAATTCAGAGATAAAGACTGG - Intronic
1015186673 6:130424917-130424939 GGAAAAGCAGAGAGGCAGAGAGG - Intronic
1015841654 6:137483623-137483645 GGAAATGAAGATATGAAAAGAGG + Intergenic
1016659005 6:146554432-146554454 TGTAATGCAGAAATGAAGAACGG - Intronic
1017292859 6:152761537-152761559 GGAGATGCTGAGCTGCAGATGGG + Intergenic
1017501668 6:155031425-155031447 GAAAATGAAGAGATGAGGCTGGG + Intronic
1017586928 6:155936802-155936824 TGAAATGCAGAGTTCAAGCTGGG - Intergenic
1020353634 7:7252706-7252728 GGAGATGGAGAGAGGAAGAACGG + Intergenic
1020572455 7:9883150-9883172 GAAAATGCGGAGATGGAGATTGG + Intergenic
1020618150 7:10485735-10485757 GTAAATGCTGAGAAGAACATAGG - Intergenic
1020625578 7:10574799-10574821 GAAAATACAGAGACCAAGATTGG - Intergenic
1020822138 7:12983578-12983600 GCAAATTCTGAGATGTAGATAGG + Intergenic
1021075388 7:16297919-16297941 GGATATACAGAGATATAGATAGG - Intronic
1021228021 7:18051263-18051285 AGCAATGCAGAGATGAAGCTTGG + Intergenic
1022034532 7:26521129-26521151 GGAAATGCAGGGAGGAGAATGGG + Intergenic
1022943923 7:35263306-35263328 GGAAATGCAAAGAAAAAAATGGG - Intergenic
1023878629 7:44306479-44306501 ATAAATACAGAGATGAAGACAGG + Intronic
1024134845 7:46396089-46396111 GGAAGTGCAGTGACAAAGATGGG + Intergenic
1024835853 7:53517677-53517699 ACAAATGCATAGATTAAGATTGG - Intergenic
1026222561 7:68413256-68413278 AGAAAAGAAGAAATGAAGATAGG - Intergenic
1026525302 7:71148047-71148069 GGAAAGACAGAGATGAACAAGGG - Intronic
1026652015 7:72223951-72223973 GTACACGCAGACATGAAGATGGG + Intronic
1026930000 7:74218500-74218522 GGGAATGCAGAGATGAGGGCCGG - Intronic
1026952813 7:74358876-74358898 AGCAATGCAGACATCAAGATGGG - Intronic
1026979001 7:74515740-74515762 GGGAATGCAGAGATGAGGAAGGG - Intronic
1027726789 7:81815453-81815475 TGAACTACAGAGATGAAAATGGG - Intergenic
1028772886 7:94647376-94647398 GGTGATGGGGAGATGAAGATAGG - Intronic
1029027868 7:97436867-97436889 GGAAATGCAGTCATGAGGAAAGG - Intergenic
1029587292 7:101483120-101483142 GGAAATGTAGGGAAGAAAATGGG + Intronic
1029931054 7:104371269-104371291 AGAAGTGGAGAGATGAAAATGGG - Intronic
1029942268 7:104492899-104492921 GGAAAAGAAGAGATGAAAGTAGG - Intronic
1030200359 7:106896703-106896725 GGAAATGCAGAGGGGATGGTAGG + Intronic
1030440179 7:109579507-109579529 AGAAGTGCAGAGATGAACATGGG + Intergenic
1030534996 7:110755695-110755717 GGAACTGAGGAGAAGAAGATGGG + Intronic
1031544716 7:123036541-123036563 TGAGATGCAGACATAAAGATAGG - Intergenic
1031648743 7:124259768-124259790 GAAAAGGTAGATATGAAGATGGG + Intergenic
1033598205 7:142871176-142871198 GGCACTGCAGAGATGCAGAAGGG + Intergenic
1033937164 7:146600757-146600779 GGAAATGCATAGATGAATAAGGG - Intronic
1033941527 7:146660954-146660976 TGAAGTGCAGAGATAAGGATGGG + Intronic
1033991740 7:147296308-147296330 GGAAATGCTATGGTGAAGATAGG + Intronic
1034117921 7:148600636-148600658 TGAAATGCAGAAATGAATATAGG - Intronic
1035404831 7:158589978-158590000 GGAGAGGCAGAGAGGAAGAGAGG - Intergenic
1036506298 8:9359639-9359661 GGGATTGGAGAGATGAAGATGGG - Intergenic
1037216925 8:16465728-16465750 AGAAATAAAGAGATGTAGATGGG + Intronic
1037282244 8:17255070-17255092 GGAAATACAGAGATGAATATGGG - Intronic
1038172232 8:25146177-25146199 GGAAATGCAGACAGGACGGTAGG + Intergenic
1038529872 8:28309825-28309847 GGATAGGCAGAGATGAAGAAAGG - Intergenic
1038644136 8:29349327-29349349 GCAAATGCAGAAAGGGAGATTGG - Intronic
1039165916 8:34679841-34679863 GGAAGTGCAGAGGTTAAGATGGG + Intergenic
1039277180 8:35946160-35946182 AGAAATGCAGGCATGGAGATTGG - Intergenic
1040727093 8:50394362-50394384 GAAAATGGAGAGAGGAGGATGGG + Intronic
1041087741 8:54272202-54272224 GGAAAGGAAGACATGAACATAGG - Intergenic
1041145101 8:54867158-54867180 AGATATGCAGAGATGCACATTGG + Intergenic
1041687373 8:60656898-60656920 GCAAAGGCAGAGATGCAGAAAGG + Intergenic
1041803792 8:61827956-61827978 GGAAAGGCAGAAAGGCAGATGGG + Intergenic
1042155022 8:65835506-65835528 GGAAAAGAAGAGCTGAAGAAAGG - Intronic
1042784665 8:72535202-72535224 GGAAATGCAGAGCTGGAGCTTGG + Intergenic
1044335479 8:90979273-90979295 GGATCTGCAGAGATGAAGGGGGG + Intronic
1045628463 8:104085918-104085940 GGAAATACAGATCTGAAGCTTGG + Intronic
1046027611 8:108744475-108744497 GGAAAGGCAGGTATGAAGAAGGG + Intronic
1046449912 8:114375291-114375313 TTCAAAGCAGAGATGAAGATTGG + Intergenic
1046841895 8:118868300-118868322 GGAAATGCAGGGAGGCAGAGGGG - Intergenic
1047283775 8:123468364-123468386 GGATATGGAGAGAGGAAAATGGG - Intergenic
1048048916 8:130798798-130798820 GAACATGCTGAGATGAACATGGG - Intronic
1048332767 8:133482380-133482402 GCAAATTCAGAGAAGAGGATGGG + Intronic
1048369533 8:133765688-133765710 GGGACTGGACAGATGAAGATAGG - Intergenic
1048436486 8:134423254-134423276 GGAAAGTCAGAGATAAAGAGGGG + Intergenic
1048457055 8:134587737-134587759 GGGAATGGAGAGAAGAAGGTAGG - Intronic
1048508263 8:135040339-135040361 GCAAATGCTGAGATAGAGATTGG - Intergenic
1049528815 8:143143057-143143079 GGACCTGCAGAGCTGGAGATGGG - Intergenic
1049970587 9:818554-818576 GAAAAGGTAGAGGTGAAGATCGG + Intergenic
1051154511 9:14125706-14125728 GGAGATGCAGAGCTGAACAATGG + Exonic
1051559185 9:18421092-18421114 GGAAATGCAGAGGGTAAGAGAGG + Intergenic
1052043698 9:23770246-23770268 GAAAATGTGGAGATGAAGACGGG + Intronic
1052681507 9:31699066-31699088 GATAATGAAGATATGAAGATGGG - Intergenic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1053030454 9:34772441-34772463 GGACTTGCAGAGAGGAAGGTCGG + Intergenic
1053143870 9:35698964-35698986 GTAAAGTCAGAGATGAAGGTGGG + Intronic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1055537076 9:77259498-77259520 GAAAATGCAGGGATAAAAATGGG + Intronic
1055991743 9:82113704-82113726 TGAAATGCAGTAATGAATATGGG - Intergenic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1057456294 9:95215369-95215391 GGAGATGGAGAGAGGGAGATAGG + Intronic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1057808784 9:98241586-98241608 GAAAATGCAGAGACCAAGAAAGG - Intronic
1058154800 9:101503166-101503188 TGGAATGCAGACATGAAGCTTGG + Intronic
1058326104 9:103699883-103699905 GGTAATGCAGATATCAAGAATGG + Intergenic
1058822423 9:108744921-108744943 GGGAAGGGAGGGATGAAGATGGG - Intergenic
1059913543 9:119073941-119073963 AGAAATACACAGATGTAGATAGG + Intergenic
1060399274 9:123338717-123338739 GGAACAGCAGGGATGGAGATCGG + Intergenic
1060548084 9:124472243-124472265 GAAGATTCAGAGATGAAGATTGG - Intronic
1061886702 9:133594715-133594737 GGGAGTGCAGAGAGGAAGAATGG + Intergenic
1185872083 X:3673000-3673022 AGAAATGCAGAAAGGAAGAAAGG + Intronic
1185884254 X:3768207-3768229 CGATGTGTAGAGATGAAGATTGG + Intergenic
1186346973 X:8703664-8703686 TTAAAAGGAGAGATGAAGATTGG + Intronic
1186349526 X:8728764-8728786 GGAAAGGAAGAAAGGAAGATGGG - Intronic
1186759572 X:12709321-12709343 GAAAAAGCAGATATGAAGAGAGG - Intronic
1187480888 X:19654357-19654379 GGAAATGCAGTGTCGAAGATGGG + Intronic
1188421914 X:30000606-30000628 GGAAATGCACAAATGAATTTCGG + Intergenic
1189208477 X:39262591-39262613 ACAGATGCTGAGATGAAGATTGG + Intergenic
1189419099 X:40840501-40840523 TGAGTTGAAGAGATGAAGATTGG - Intergenic
1189445200 X:41074882-41074904 GGAGATGCAGAGAGGCAGGTTGG + Intergenic
1189648507 X:43161467-43161489 GGAAATGAAGGCATGCAGATTGG + Intergenic
1189710739 X:43809099-43809121 GGAAATGCTGTGATGAGGGTGGG + Intronic
1190061090 X:47212137-47212159 GGAGATGGAGAGATCAAGATGGG - Intronic
1190193358 X:48295642-48295664 GTAAATGCAGAGGAGAAAATCGG + Intergenic
1190472693 X:50798832-50798854 GGAAATGCACAGTAGAAAATTGG - Intronic
1190478808 X:50854119-50854141 GGAAATGAAGAGATGGGGAAGGG - Intergenic
1190659865 X:52644265-52644287 GTAAATGCAGAGGGGAAAATCGG + Exonic
1190676864 X:52790079-52790101 GTAAATGCAGAGGGGAAAATCGG - Intronic
1191126808 X:56964711-56964733 GGAAATGGAGAGAGGTGGATTGG + Intergenic
1191155462 X:57267724-57267746 AGAAGTTCAGAGATGAAGGTTGG + Intergenic
1191609693 X:63099499-63099521 GGCAAGGGAGAAATGAAGATAGG + Intergenic
1191939812 X:66466408-66466430 GGAAATGAAGACTTGAAGAAAGG + Intergenic
1192495078 X:71611023-71611045 GGAAATGCAGAGAGAAAGGCAGG - Intronic
1193998350 X:88394327-88394349 GGAAATGTAGGGATGGAGATTGG + Intergenic
1195026239 X:100880458-100880480 GGAAATGCAAACATTAAGACAGG - Intergenic
1195619497 X:106938856-106938878 GAAATTGCAAAGATGGAGATGGG + Intronic
1195849273 X:109265218-109265240 GGCAATGAAGAGATAGAGATAGG - Intergenic
1196216311 X:113056080-113056102 AAAAATGCAGAGATGAATGTAGG + Intergenic
1196502116 X:116396790-116396812 GTAAATGTGGACATGAAGATGGG - Intergenic
1196980937 X:121213041-121213063 GGAGAGGCAGAGATAAAGGTGGG - Intergenic
1198089892 X:133318166-133318188 AGAATTGCAAAGAGGAAGATGGG - Intronic
1198578041 X:138032457-138032479 GTATATGTAGACATGAAGATAGG + Intergenic
1198628018 X:138601412-138601434 TGAAATTCAGATATGAAGCTAGG + Intergenic
1200066432 X:153506289-153506311 GGAGTGCCAGAGATGAAGATGGG - Intronic
1200250670 X:154552241-154552263 GGAAACGCAGAGGTGCAGGTGGG - Intronic
1201867925 Y:18674069-18674091 GGACAGGCAGAAATGAAGTTTGG + Intergenic