ID: 985724800

View in Genome Browser
Species Human (GRCh38)
Location 5:1510537-1510559
Sequence CTCGTAAGACGCCCGTGGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 41
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 38}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985724800_985724806 16 Left 985724800 5:1510537-1510559 CCAGTCCACGGGCGTCTTACGAG 0: 1
1: 0
2: 0
3: 2
4: 38
Right 985724806 5:1510576-1510598 GAATGGGATCAAAGCCAGTCTGG No data
985724800_985724805 0 Left 985724800 5:1510537-1510559 CCAGTCCACGGGCGTCTTACGAG 0: 1
1: 0
2: 0
3: 2
4: 38
Right 985724805 5:1510560-1510582 GATGCTGCACGGTGTTGAATGGG 0: 1
1: 0
2: 0
3: 4
4: 45
985724800_985724804 -1 Left 985724800 5:1510537-1510559 CCAGTCCACGGGCGTCTTACGAG 0: 1
1: 0
2: 0
3: 2
4: 38
Right 985724804 5:1510559-1510581 GGATGCTGCACGGTGTTGAATGG 0: 1
1: 0
2: 0
3: 2
4: 70
985724800_985724807 22 Left 985724800 5:1510537-1510559 CCAGTCCACGGGCGTCTTACGAG 0: 1
1: 0
2: 0
3: 2
4: 38
Right 985724807 5:1510582-1510604 GATCAAAGCCAGTCTGGTCTTGG 0: 1
1: 0
2: 1
3: 14
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985724800 Original CRISPR CTCGTAAGACGCCCGTGGAC TGG (reversed) Intronic
900148694 1:1169007-1169029 CTGGTAAGACGCCCATCGGCCGG - Intergenic
900957271 1:5893812-5893834 CTGGGAAGACGCCCGTTGCCAGG - Intronic
901040962 1:6363263-6363285 CTGGGAAGACGCCCGTTGCCAGG + Intronic
907482139 1:54752571-54752593 CTCGCAAGACACCCGAGGACAGG - Intergenic
919958103 1:202438927-202438949 CCCCGAAGACGGCCGTGGACTGG + Intronic
1063985272 10:11495074-11495096 CTGGGAAGACGCCCGTTGCCAGG - Intronic
1076419600 10:130321582-130321604 CTGGGAAGACGCCCGTTGCCAGG + Intergenic
1077388365 11:2286532-2286554 CTGGGAAGACGCCCGTTGCCAGG - Intergenic
1083910518 11:65706449-65706471 CTGGGAAGACGCCCGTTGCCAGG + Intergenic
1092444136 12:8538022-8538044 CTGGGAAGACGCCCGTGGCCAGG + Intronic
1095951659 12:47785021-47785043 CTCCTGAGACGCCTGTGGCCAGG + Intronic
1104961244 12:132489655-132489677 CTCGGAAGCCGCCCGCGGCCGGG + Exonic
1120840739 14:89082927-89082949 CTCTTAAGAAGTCTGTGGACTGG - Intergenic
1142587392 17:982126-982148 CTGGGAAGACACCCGTGGCCAGG + Intergenic
1146356131 17:32135702-32135724 CTGGGAAGACGCCCGTTGCCAGG - Intergenic
1162613106 19:11771736-11771758 CTGGGAAGACGCCCGTTGCCAGG + Intronic
1166281988 19:41800323-41800345 CTGGGAAGACGCCCGTTGCCAGG + Intronic
1167991020 19:53360661-53360683 CTGGGAAGACGCCCGTTGCCAGG - Intergenic
948607599 2:239146106-239146128 CTCGTCAGTAGCCCGTGGAGAGG - Intronic
1172783810 20:37452596-37452618 CTCTCAAGATGCCCGTGGTCTGG - Intergenic
957890131 3:86345935-86345957 CTCGTAGAACCCCCGTTGACTGG - Intergenic
958657323 3:97018886-97018908 CTGGGAAGACGCCCGTTGCCAGG - Intronic
965439824 3:168699045-168699067 CTGGGAAGACGCCCGTTGCCAGG - Intergenic
975387503 4:73774218-73774240 CTGGGAAGACGCCCGTTGCCAGG - Intergenic
985724800 5:1510537-1510559 CTCGTAAGACGCCCGTGGACTGG - Intronic
998539360 5:142965418-142965440 CTGGGAAGACGCCCGTTGCCAGG - Intronic
1025787718 7:64658777-64658799 GTCATAATACACCCGTGGACAGG - Intergenic
1029699719 7:102238294-102238316 CTGGGAAGACGCCCGTTGCCAGG - Intronic
1033785641 7:144727056-144727078 CTGGGAAGACGCCCGTTGCCAGG + Intronic
1036785025 8:11680302-11680324 CTCGGAAGATCCCCGCGGACAGG + Intronic
1041384098 8:57280218-57280240 CTGCTGAGACGCCTGTGGACTGG - Intergenic
1043978285 8:86608368-86608390 CTGGGAAGACGCCCGTTGCCAGG + Intronic
1045276183 8:100707851-100707873 CTGGGAAGACGCCCGTTGCCAGG - Intronic
1048241071 8:132741955-132741977 CTGGGAAGACGCCCGTTGCCAGG - Intronic
1052956540 9:34256850-34256872 CAAGTAAGGGGCCCGTGGACTGG - Exonic
1061835903 9:133329478-133329500 CTGGGAAGACGCCCGTTGCCAGG - Intergenic
1062183956 9:135206481-135206503 CTGGGAAGACGCCCGTTGCCAGG - Intergenic
1062531734 9:137004485-137004507 CTGGGAAGACGCCCGTTGCCAGG + Intergenic
1062588508 9:137262332-137262354 CTGGGAAGACGCCCGTTGCCAGG - Intronic
1062647940 9:137559318-137559340 CTGGGAAGACGCCCGTTGCCAGG + Intronic
1198287496 X:135206651-135206673 CTGGGAAGACGCCCGTTGCCAGG + Intergenic