ID: 985725692

View in Genome Browser
Species Human (GRCh38)
Location 5:1514803-1514825
Sequence CTGTTTTGGCTGGAGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 392
Summary {0: 1, 1: 0, 2: 3, 3: 39, 4: 349}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985725692_985725703 29 Left 985725692 5:1514803-1514825 CCTTCCACCTCCAGCCAAAACAG 0: 1
1: 0
2: 3
3: 39
4: 349
Right 985725703 5:1514855-1514877 TTCAGCCCAGGCCCTGAGACAGG 0: 1
1: 0
2: 2
3: 41
4: 281
985725692_985725700 17 Left 985725692 5:1514803-1514825 CCTTCCACCTCCAGCCAAAACAG 0: 1
1: 0
2: 3
3: 39
4: 349
Right 985725700 5:1514843-1514865 GCACGCTTCCCATTCAGCCCAGG 0: 1
1: 0
2: 1
3: 9
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985725692 Original CRISPR CTGTTTTGGCTGGAGGTGGA AGG (reversed) Intronic
900505261 1:3027205-3027227 CTGCTTTGTCTGCAGGTGGAGGG + Intergenic
900768359 1:4520525-4520547 CTGTGTGTGGTGGAGGTGGAAGG - Intergenic
900768411 1:4520789-4520811 CTGTCTGTGGTGGAGGTGGAGGG - Intergenic
900768442 1:4520933-4520955 CTGTCTGTGGTGGAGGTGGAGGG - Intergenic
901001710 1:6152078-6152100 CCATTTGGGCAGGAGGTGGAGGG - Intronic
902284774 1:15400410-15400432 CTGTCTTGGCTGGGGCTGGATGG + Intergenic
904372555 1:30059057-30059079 CTCTTTTGGTTGGAAGTCGAAGG - Intergenic
904391870 1:30191327-30191349 ATGTTTTGGGTGGAGATGGGTGG + Intergenic
904530347 1:31164544-31164566 CAGCTTGGGCTGGGGGTGGAGGG - Intergenic
904592300 1:31621628-31621650 CTGTGTGGGCTGGGGGTGGGAGG + Intronic
905022316 1:34826438-34826460 CTGCTTTGGATGGAGGAGGGGGG - Intronic
905677026 1:39833824-39833846 TGGTGTTGGCTGGGGGTGGAGGG - Intergenic
906380111 1:45327248-45327270 CTGGCTTCGCGGGAGGTGGACGG + Exonic
906615389 1:47229879-47229901 CGCTTTGGGCTGGAGGTGGGTGG - Intronic
907399802 1:54217968-54217990 TTGTTTTGGCTGAAGGGGGCTGG + Intronic
909386864 1:75067953-75067975 CTGTTTTGGCTTGAGGAAAAAGG - Intergenic
911055547 1:93705464-93705486 GTGTTAGGGCTGGAGGTGGTCGG - Intronic
913478729 1:119264061-119264083 CAGTTTTGGCTGAGGGTGGGGGG - Intergenic
913478767 1:119264435-119264457 CAGTTTTGGCTGAGGGTGGGGGG + Intergenic
913486663 1:119337826-119337848 CTGTGTTGGTTGAAGGTGGGTGG + Intergenic
917238276 1:172918280-172918302 TTGTTCTGGGTGGAGGTGGTAGG - Intergenic
918095096 1:181327891-181327913 CTGGCCTGGCTGGAGTTGGATGG + Intergenic
918291073 1:183108385-183108407 CTGATTTTGCTGTAGGTGGCAGG + Exonic
918939457 1:190972906-190972928 CTGGTATGGCTGGAAGTAGAAGG - Intergenic
919569692 1:199231987-199232009 CTCTTTTGGGTGGTGGTGGGTGG - Intergenic
921027421 1:211299357-211299379 TTGTTTTGGATGGAGGTAAATGG + Intronic
921708519 1:218350358-218350380 TTGTCATGACTGGAGGTGGAGGG + Intronic
922089866 1:222385766-222385788 CTCTTTTGGCTGAGGGTGGTGGG - Intergenic
923181214 1:231521741-231521763 CTGGCTGGGGTGGAGGTGGAGGG - Intergenic
923538254 1:234869622-234869644 CTGGTTTGGAGGGAGGAGGATGG - Intergenic
923941404 1:238831518-238831540 CAGTCATGGCTGAAGGTGGAGGG - Intergenic
924152216 1:241141000-241141022 CTGTTTGGGGTGAAGGTGGTGGG - Intronic
1064293152 10:14053708-14053730 GTCTTTTTGATGGAGGTGGATGG - Intronic
1064302318 10:14133610-14133632 CTTTGCTGGCTGGAGGAGGAAGG + Intronic
1064509699 10:16076659-16076681 CTGATATGACTGGATGTGGAGGG - Intergenic
1065121056 10:22530693-22530715 TTTTTTTGGCTGGAGGAGGGAGG + Intergenic
1065314636 10:24451345-24451367 ATGTTAAGGCTGAAGGTGGAGGG + Intronic
1066094213 10:32056886-32056908 CATTTTTGTCTGGGGGTGGAGGG + Intergenic
1067682868 10:48451304-48451326 CTGTCCTGCCTGGAGTTGGAGGG - Intronic
1067832145 10:49616423-49616445 GTCTGTTGGCGGGAGGTGGAGGG + Intronic
1068185389 10:53578533-53578555 CTGTTGTGGGTAGAGGGGGAGGG + Intergenic
1069623138 10:69850080-69850102 CTGGGTGAGCTGGAGGTGGAGGG + Intronic
1069623334 10:69851295-69851317 TTGTTTTGGCTCAGGGTGGAAGG - Intronic
1070178357 10:73991938-73991960 TGGTTTTGGGTGGAGGTGGAGGG + Intergenic
1070577694 10:77691998-77692020 ATGTTTTGTCTGGGGTTGGATGG + Intergenic
1073066904 10:100766495-100766517 CTGTTGGAGCTGGAGGAGGATGG - Intronic
1073093864 10:100968481-100968503 CTGTCATGGATGGAGGAGGAAGG + Intergenic
1074318582 10:112380491-112380513 GTATTTCTGCTGGAGGTGGAGGG - Intronic
1074788048 10:116859101-116859123 TTTTTTTGGTAGGAGGTGGAGGG - Exonic
1075322044 10:121499295-121499317 CTGAATTAGCTTGAGGTGGAGGG - Intronic
1076688075 10:132207112-132207134 CTGGTCTCGCTGGAGGAGGACGG - Intergenic
1077609563 11:3636015-3636037 CTTTTTTGCCTGGGGGTGGGGGG + Intergenic
1077799308 11:5522399-5522421 CTGCTGTGCCTGGAGCTGGAGGG - Intronic
1078290525 11:10006160-10006182 CTGACTTGCCTCGAGGTGGACGG - Intronic
1078854736 11:15197802-15197824 GTGTGTGGGCTGGTGGTGGAAGG - Intronic
1080385575 11:31809132-31809154 CTCTTTTGGCTGGGGGCGGGAGG - Intronic
1081694911 11:45102963-45102985 CTGTTTACCCTGGAGGGGGAAGG + Intronic
1082811074 11:57479372-57479394 CTGTCTGGGCTGGTGGTGGGAGG - Intergenic
1083043993 11:59715872-59715894 ATGTTTTGGGTGGAGATAGAGGG + Intronic
1084536142 11:69758392-69758414 CCGTTCTGGCTGAAGGTCGAGGG + Intergenic
1084954468 11:72684092-72684114 CTGTCCTGGCTGGAGGCAGAAGG + Intergenic
1085439379 11:76544485-76544507 CTGGTCTGCCTGCAGGTGGATGG - Exonic
1086074305 11:82834079-82834101 CTTACATGGCTGGAGGTGGAAGG - Intronic
1086106974 11:83157219-83157241 CTGTGGCGGCTGGAAGTGGACGG + Exonic
1086864224 11:91960143-91960165 TTGTTTTGGCTTGAGTTGGTTGG - Intergenic
1087978160 11:104576056-104576078 CTTTTTTGGGTGGAAGAGGAGGG - Intergenic
1088828268 11:113513954-113513976 ATCTGTTGGCTGGAGCTGGAAGG + Intergenic
1088895012 11:114071746-114071768 CTGTTTTGGCTGGGTGTGTGGGG + Intronic
1089614925 11:119689873-119689895 CTGCTTTGGAAGCAGGTGGAGGG - Intronic
1090662889 11:128894350-128894372 CTATTTAGGCTGGAGGTGGAAGG + Intronic
1091401921 12:186313-186335 CTGCTGTGGCTGCCGGTGGAAGG - Intergenic
1091843785 12:3639093-3639115 CTGCTATGTCTGGAGGTGGGGGG - Intronic
1092286580 12:7132145-7132167 CTGAATTGGCTGGTGGTTGAAGG + Intronic
1092899491 12:13044809-13044831 CTGTCTTGGCTGGACCTGGGCGG + Intronic
1095040029 12:37431316-37431338 CTTTTGTGGCAGGAGGTGAATGG + Intergenic
1095854345 12:46843855-46843877 CTTTTATGGCAGGAGGAGGAAGG - Intergenic
1095971101 12:47902554-47902576 CTGTTTTGGATGCAGGTAGAGGG - Intronic
1096651136 12:53062488-53062510 CTGCTTTGGCTGCAGGGGGTAGG - Intronic
1096660469 12:53121038-53121060 CTGGCTTGTCAGGAGGTGGAGGG - Intronic
1096737145 12:53664477-53664499 CTCTTTTGGCTGAGGGTGGATGG + Intronic
1096844728 12:54399909-54399931 CCGTTTTTGCTGGTGGTGCAGGG + Exonic
1097680868 12:62647768-62647790 CTGTGTGGGCTGGAGGAGGTGGG + Exonic
1100418551 12:94405568-94405590 CTATCTTGGCTGAAAGTGGAAGG - Intronic
1100721880 12:97368035-97368057 CTGGTTTGGCTGGGGCTGGATGG + Intergenic
1101051331 12:100867057-100867079 CTGATGGGGCTGGAGGTGGGAGG + Intronic
1101745762 12:107540254-107540276 CTCATATGGCAGGAGGTGGAAGG + Intronic
1102214405 12:111150298-111150320 CTTTTTTGGGGGGAGGAGGAAGG - Intronic
1104064434 12:125295370-125295392 CTGTTGGGGCAGGAGCTGGAAGG + Intronic
1104533633 12:129596810-129596832 CTTTATTGGCGGGGGGTGGATGG - Intronic
1104533752 12:129597882-129597904 CTTTATTGGCGGGGGGTGGATGG + Intronic
1104746254 12:131212236-131212258 CTCTTTTGGCCGGAAATGGATGG + Intergenic
1106989871 13:35406020-35406042 CTTTTTTTTCTGGAGATGGAGGG - Intronic
1107935199 13:45340716-45340738 GGGTTGTGCCTGGAGGTGGAGGG - Exonic
1109741210 13:66558387-66558409 CTGTCTTGTAAGGAGGTGGAGGG + Intronic
1111612007 13:90616946-90616968 CTGTTTGAGCTGGATGTGCATGG - Intergenic
1111689514 13:91544877-91544899 CAGTCTTGGCTGGAGCTGGAGGG + Intronic
1112110413 13:96290860-96290882 CAGTTGTGGCTGGAGGTAGGAGG - Intronic
1113013114 13:105793461-105793483 CACTTGTGGCTGGAGGAGGAAGG + Intergenic
1113791058 13:113028516-113028538 CTGGTCTGGCTGAAGGTGGCCGG + Intronic
1114411185 14:22502012-22502034 CAGCTTTGTCAGGAGGTGGAAGG + Intergenic
1114704919 14:24715106-24715128 CTGTCTGGGATGGAGGTGGGGGG + Intergenic
1115501323 14:34052596-34052618 GTGTGTTGGCTGGGGGTGGTGGG - Intronic
1116031942 14:39584413-39584435 CTGTTGTGGCTTGAGGTGAGGGG - Intergenic
1116452976 14:45084582-45084604 CTGGGGTGGCTGGAAGTGGAAGG + Intronic
1117462934 14:55964232-55964254 TTGTCTTGCCTGGAGGCGGACGG - Intergenic
1118133381 14:62993448-62993470 TGGTTTAGTCTGGAGGTGGATGG - Intronic
1118697784 14:68401621-68401643 GTCTCTTGGCTGGAGGTGAAAGG - Intronic
1119122235 14:72090371-72090393 CTGATCTGACAGGAGGTGGACGG - Intronic
1119529192 14:75347784-75347806 CTGCTTGGGCAGGAGGTGGATGG + Intergenic
1120286137 14:82504511-82504533 GTGTTTTGGTGGGAGGTGAAAGG + Intergenic
1120710715 14:87790217-87790239 TTGTTGTGGTAGGAGGTGGAAGG + Intergenic
1121632940 14:95434052-95434074 CTGATATGGCTGGAGTTGGGTGG + Intronic
1124093736 15:26629494-26629516 ATGTGTTGGCAGGAGGAGGAGGG + Intronic
1124126369 15:26941304-26941326 GTTTTTTGGCGGGGGGTGGAGGG + Intronic
1124423456 15:29541950-29541972 CTGTTTTGGCTTGAAGTGGTAGG + Intronic
1124514246 15:30352734-30352756 CTGTCCTGACTGGAGGTTGAAGG + Intergenic
1124720115 15:32104430-32104452 CAGAGTGGGCTGGAGGTGGAGGG - Intronic
1124728673 15:32178030-32178052 CTGTCCTGACTGGAGGTTGAAGG - Intergenic
1125490280 15:40142420-40142442 CTGGTCTGGCTACAGGTGGATGG + Intergenic
1125861665 15:43005406-43005428 CTGTCTTGGAGGGAGGTGGGGGG + Intronic
1126103302 15:45132657-45132679 CTGTCCTGGCTGGAGGTGACAGG + Intronic
1126997384 15:54460496-54460518 CTGTAATGGCTGGAGTTGGTTGG + Intronic
1127263237 15:57341134-57341156 CTCTCTTGTCTGGAGGTGCAGGG + Intergenic
1129271310 15:74420727-74420749 CAGTTTGGGCTGCGGGTGGAAGG - Intronic
1130094083 15:80843465-80843487 CAGTTCTGGCTGGAGGGGCAGGG + Intronic
1130348211 15:83067655-83067677 GTGTTTTGCCTGGAAGTGGAGGG + Intergenic
1130645773 15:85725375-85725397 CTTTTTTGGGGGGAGGGGGAGGG + Intronic
1131272111 15:90953786-90953808 CAGCTTTGGCTGGTGGTGGCTGG + Exonic
1131442116 15:92467120-92467142 CTGTTGGGGCTTGAGGTGAATGG - Exonic
1132400003 15:101499281-101499303 CTGTTTTAGATGGGGGTGCAGGG - Intronic
1132580540 16:682785-682807 CTGTTTTGGCTAGCCGAGGAAGG + Exonic
1133873523 16:9711651-9711673 CTAATTTGGCTGGAGGAGTAGGG - Intergenic
1134193050 16:12137270-12137292 GTGTCTTGGCTGTAGGTGGCTGG + Intronic
1134402784 16:13925530-13925552 AAGTTTTGGATAGAGGTGGATGG - Intronic
1136613872 16:31383599-31383621 CATTTTTGGCTGGAGGTAAAGGG - Intergenic
1136695882 16:32081667-32081689 CGGTTCTGCCTGTAGGTGGAGGG - Intergenic
1136796377 16:33024920-33024942 CGGTTCTGCCTGTAGGTGGAGGG - Intergenic
1136873538 16:33829472-33829494 CGGTTCTGCCTGTAGGTGGAGGG + Intergenic
1137819887 16:51434126-51434148 CTGTTTTTATTGGAGGGGGAGGG + Intergenic
1138593846 16:58018799-58018821 CTGTTTTGTCTGTCTGTGGAGGG + Intronic
1139397278 16:66650202-66650224 CTTGGTTGGCTGGAGGTGGGTGG + Intronic
1141040951 16:80671792-80671814 CTTTTTTGGATGGAGTTAGAAGG + Intronic
1203098636 16_KI270728v1_random:1286583-1286605 CGGTTCTGCCTGTAGGTGGAGGG - Intergenic
1142776463 17:2143929-2143951 CAGTTTTGGCTGCAAGTGGCAGG + Intronic
1143330309 17:6130070-6130092 CTTTTTTGCCTCGAGGTAGATGG + Intergenic
1143674514 17:8422104-8422126 CTGCAATGGCTGGGGGTGGAGGG + Intronic
1144274829 17:13656356-13656378 CTGTTTTGGCTGCAAATGGGTGG - Intergenic
1144637592 17:16920166-16920188 CTTTTAGGGCTGGAGGTGGTAGG + Intergenic
1145222024 17:21097280-21097302 CTTTTTTTGCTGGTGGTGGAAGG + Intergenic
1145240780 17:21240155-21240177 CTTTTGTGCCTGGAGGTGGCAGG + Exonic
1146183475 17:30710829-30710851 CTGCCATGGCTGGGGGTGGATGG - Intergenic
1146460328 17:33041109-33041131 CTGTGTGGGCAGGAGGAGGAGGG - Intronic
1146499170 17:33349569-33349591 CGGCTTTGGGTGGAGCTGGAGGG - Intronic
1147038922 17:37702194-37702216 CTGTTTTAGGTGGATGTGGAAGG + Intronic
1147662931 17:42126849-42126871 CTGGTTTGGATGGAGGTGAGAGG + Intronic
1147953511 17:44120017-44120039 CTGTCTTGGCTGGATGTGGGAGG - Intronic
1148094090 17:45040490-45040512 CTGGCTTGGCTGGAGGCGGAAGG + Intronic
1148202226 17:45756768-45756790 CTGTCTTGGCTGTCGGTGGGTGG + Intergenic
1150074841 17:62183627-62183649 CTCTCTTGGATGGAGGAGGAGGG + Intergenic
1150412442 17:64956574-64956596 CTGTGTTGGCTGGAGAGGGATGG + Intergenic
1150563746 17:66319126-66319148 TTTTTTTGGGTGGGGGTGGAGGG - Intronic
1150570812 17:66385457-66385479 ATATTTTGGCTGGAGGAGAAGGG - Intronic
1150799453 17:68269049-68269071 CTGTGTTGGCTGGAGAGGGATGG - Exonic
1151030395 17:70731053-70731075 CTGGTTTGGCTGAAGCTGGATGG - Intergenic
1151404661 17:73878554-73878576 CTGTTGTGGCTGGGGTTGGGAGG + Intergenic
1153367665 18:4276140-4276162 CTTTTTTGGCGGGGGGTGGGAGG + Intronic
1153762012 18:8340613-8340635 CTGTTTTGCTTGGATGTAGAAGG - Intronic
1154024530 18:10695199-10695221 CTGTTTTGCCTGGAGGCGTGAGG + Intronic
1156492551 18:37505007-37505029 CTGCAGTGGCTGGAGGAGGATGG - Intronic
1156659791 18:39333701-39333723 CTGCTCTGGCTGGAGGTGATTGG - Intergenic
1156858688 18:41812580-41812602 CTATGTTGGCTGGAGGTGGTGGG + Intergenic
1157087053 18:44591665-44591687 CTGTTTTGACTCGAGTTAGATGG + Intergenic
1159387186 18:67741880-67741902 CTGTCTTGGCTGGGGGAGGGAGG - Intergenic
1160334676 18:78028139-78028161 TTGTGTTTGTTGGAGGTGGAGGG + Intergenic
1160755472 19:754900-754922 CTGGTTTGGGTGGAAGAGGAGGG + Intronic
1160755479 19:754924-754946 CTGGTTTGGGTGGAAGAGGAGGG + Intronic
1161199227 19:3005406-3005428 CGGTTCTGGCAGGAGGGGGATGG - Intronic
1162766507 19:12923035-12923057 CTGGTGTGGCTGAAGGCGGAGGG - Intronic
1162975317 19:14204931-14204953 CTGGCATGGCTGGGGGTGGATGG + Intronic
1163862612 19:19750116-19750138 CTGTGTAGGGTGGATGTGGAAGG - Intergenic
1164296815 19:23917984-23918006 CTCCATTGGCTGGAGTTGGATGG + Intronic
1165075901 19:33279733-33279755 CTGATTAGGCTGGAAGTGGGGGG + Intergenic
1165087939 19:33364339-33364361 GGGTTTTGGCTGGAAGAGGAAGG - Intergenic
1168191120 19:54739461-54739483 CTGGTTTGCCTGCAGATGGATGG + Intronic
1168314801 19:55480092-55480114 GTGGGTTGGCTGGAGGTGAAAGG + Intronic
1168724297 19:58572373-58572395 CTGATTTAGCTGGGGTTGGAAGG + Intronic
925576915 2:5369692-5369714 CTGTGATGGCTGGAGATGGATGG - Intergenic
925674532 2:6346954-6346976 CTGAATTACCTGGAGGTGGAAGG + Intergenic
926136289 2:10338985-10339007 CTGAGGTGGCTGGAGATGGAGGG + Intronic
926223091 2:10948961-10948983 CTGTCTTGGCTGGAGGAGTTGGG + Intergenic
928472966 2:31592237-31592259 CTGTAATGGCTTGAGTTGGATGG - Intergenic
928845426 2:35666184-35666206 ATGTGTTGGTTGGAGGTGGGGGG + Intergenic
929388730 2:41442904-41442926 CTGGAGGGGCTGGAGGTGGAGGG - Intergenic
929535712 2:42783133-42783155 CTTTGTTGGCTGATGGTGGAGGG - Intronic
929938496 2:46312602-46312624 GTGATTTGGCTGCAGTTGGAAGG + Intronic
930964052 2:57298021-57298043 CTGTTGTTGCTGGGGCTGGAGGG - Intergenic
931080528 2:58764668-58764690 TTGTTTTGGATAGAGGTGGGTGG + Intergenic
931550260 2:63436939-63436961 CAGTTATAGCTGGAGGGGGAGGG + Intronic
932166416 2:69511731-69511753 TTGTTTTGTCTCGAGGTTGATGG + Intronic
932496436 2:72147941-72147963 CTGTTTCGGCTGGAGGTGCCAGG - Exonic
933680378 2:85094717-85094739 CTGTATTGTGTGGAGGAGGATGG + Intergenic
935133154 2:100276517-100276539 CTGTTTTAACTGGAGGTCCATGG - Exonic
936775918 2:115972997-115973019 CTATTCTGACAGGAGGTGGATGG + Intergenic
937283645 2:120736625-120736647 CTGTTTTTTCAGGGGGTGGAGGG + Intronic
940504332 2:154533679-154533701 CTGTTTTGCCTGCAGGTATAAGG + Intergenic
941941332 2:171041519-171041541 CTGGTCTGACAGGAGGTGGATGG - Intronic
942525730 2:176850584-176850606 CAGAGTGGGCTGGAGGTGGAAGG + Intergenic
943390713 2:187264436-187264458 CTGTTGTGGGGTGAGGTGGAGGG + Intergenic
943458957 2:188145769-188145791 CTGTTTGGGGTGGAAGTGAAGGG + Intergenic
944975579 2:205046331-205046353 ATGTTTGGGATGGAGGTGGAGGG + Intronic
946022495 2:216650642-216650664 CTGTGGTAGCTGCAGGTGGAGGG + Intronic
946023253 2:216656331-216656353 CTATTGTGGCTGCAGATGGAAGG + Intronic
948612149 2:239176555-239176577 CTGTTGTTGCTGCAAGTGGAAGG + Exonic
948654123 2:239466162-239466184 CTGGTTTGGGTGGAGATAGAGGG - Intergenic
948685684 2:239668294-239668316 TTCTCTTGGCTGGAGGAGGAGGG - Intergenic
1168777924 20:463242-463264 CTGTTGTGGTTGGGGGTGGGAGG - Intergenic
1169959477 20:11143076-11143098 CAGGTTTGGCTGGAGGAAGATGG + Intergenic
1170157915 20:13285407-13285429 CTGGCTTGGCTGGGGCTGGATGG + Intronic
1171139786 20:22730593-22730615 CTGTTCTGGCTGCAGGATGATGG + Intergenic
1171512401 20:25696367-25696389 GTCTTTTGGCCGGAGGTGGAGGG - Intronic
1172235449 20:33369862-33369884 GTGTTTGGGCAGGAGGTTGAAGG - Intronic
1173124860 20:40327094-40327116 CTCTTATGGGTGGAGGTGGAGGG + Intergenic
1173218080 20:41105973-41105995 CTGTTGTGGGTGGGGGTGGGAGG - Intronic
1173295353 20:41750415-41750437 CTGTATGGGCTGCAGCTGGACGG + Intergenic
1174372615 20:50102850-50102872 CTGGTGTAGCTGGAGGAGGATGG - Intronic
1175929694 20:62487828-62487850 CCGTTGGGGCTGGGGGTGGAGGG + Intergenic
1176028433 20:62998204-62998226 CTCTCAGGGCTGGAGGTGGAGGG + Intergenic
1176072722 20:63235367-63235389 CTGGTATGGAGGGAGGTGGAGGG + Intergenic
1176299414 21:5091468-5091490 CTCTTGTGCCTGGAGGAGGAAGG - Intergenic
1176425208 21:6544384-6544406 CTGTCTTGGATCGAGGTGGTGGG + Intergenic
1177099731 21:16885430-16885452 CTGTTTCAGCTGAAGCTGGATGG + Intergenic
1178109171 21:29353581-29353603 CTCTGTAGGCTGGAGGTGGGTGG - Intronic
1178969396 21:37158445-37158467 ATGTTTGGGGTGAAGGTGGAAGG - Intronic
1179225232 21:39447106-39447128 TTGTTTTTGCTGGTGGTGGTGGG + Intronic
1179449829 21:41460838-41460860 CTGATTTGGGTGGTGGTGGAAGG - Intergenic
1179700699 21:43152701-43152723 CTGTCTTGGATCGAGGTGGTGGG + Intergenic
1179857612 21:44170479-44170501 CTCTTGTGCCTGGAGGAGGAAGG + Intergenic
1180792506 22:18583697-18583719 CTGATTAGGGTGGAGGAGGAGGG - Intergenic
1181229231 22:21411618-21411640 CTGATTAGGGTGGAGGAGGAGGG + Intergenic
1181249420 22:21523245-21523267 CTGATTAGGGTGGAGGAGGAGGG - Intergenic
1181404588 22:22673695-22673717 CTGCTATGGCTGGAGGAAGAGGG - Intergenic
1181687118 22:24537034-24537056 CTTTTTTTGGTGGTGGTGGAAGG + Intergenic
1181949939 22:26546537-26546559 CTGTGTTCCCTGGAGGGGGATGG - Intronic
1182066074 22:27432601-27432623 CATTTCTGGCTGGTGGTGGATGG - Intergenic
1183524855 22:38317067-38317089 TTGTTTTTGCTGGAGAGGGAGGG - Intronic
949174562 3:1044209-1044231 CAGGTGTGGGTGGAGGTGGAAGG - Intergenic
949903341 3:8838073-8838095 CTGGTTTGGCTGGGACTGGATGG - Intronic
951166714 3:19490836-19490858 CTCTTATAGCTGGTGGTGGATGG - Intronic
952494447 3:33903617-33903639 CTGCTGTGGCAGAAGGTGGAAGG + Intergenic
952562222 3:34608502-34608524 TTTTTTTGGCTGGGGGTGGGTGG + Intergenic
952810769 3:37400594-37400616 CTGTTTTGGCTGAGGCTGGCTGG + Intronic
952972095 3:38657886-38657908 CCGTGGTGGCTGGGGGTGGAGGG + Intergenic
953099905 3:39813631-39813653 CTGCAGTGGCCGGAGGTGGAGGG + Intronic
953664533 3:44916488-44916510 CCCTTTTGCCTGGAGCTGGAAGG + Intronic
954418338 3:50405224-50405246 CTGGTTGGGCTGGGGGTGGAGGG + Intronic
954602893 3:51884815-51884837 GTAATTTGGCTGGAGTTGGAAGG + Intergenic
954989611 3:54829428-54829450 CTTTTTTGGCTGGTGGAGGAGGG + Intronic
956094639 3:65703136-65703158 CTGTTTTGGCAGGGGGTGGCTGG + Intronic
956555100 3:70512641-70512663 TTGTTTTTATTGGAGGTGGAAGG + Intergenic
956929531 3:74027327-74027349 CGGTTTTGGCTGGCAGTGGGTGG - Intergenic
957623203 3:82622775-82622797 CTGTTTTTGTTGGAGATGAATGG - Intergenic
959640190 3:108623590-108623612 TTGTTTTCCCTGGAGTTGGAGGG + Intronic
960635695 3:119782342-119782364 ATCTTTTGGCTGGAGCTGAAGGG - Intronic
961466949 3:127087851-127087873 CTGGCTTGGCCAGAGGTGGAAGG + Intergenic
962574641 3:136745592-136745614 CTGATCTGACAGGAGGTGGATGG + Intronic
962835875 3:139187946-139187968 CTCTATTGGCTGAAGGTGGGAGG + Intronic
962836111 3:139190145-139190167 CTCTATTGGCTGAAGGTGGGAGG + Intronic
963141236 3:141947882-141947904 CTACTTTGGCTGGGGGTGGCTGG - Intergenic
963612360 3:147486034-147486056 CTGTTTTGACTGGAGTGAGATGG + Intronic
963859794 3:150297374-150297396 TTGAGTTGGCTGGAGGTGGAAGG + Intergenic
964044014 3:152299518-152299540 GTGTCTGGGCTAGAGGTGGAGGG - Exonic
964740402 3:159959521-159959543 CTATTTTGTTTGGAGGTTGAAGG - Intergenic
965747474 3:171940331-171940353 TTGCTTTGGCTGGTCGTGGAGGG + Intergenic
966942588 3:184756306-184756328 CTTATAAGGCTGGAGGTGGAGGG - Intergenic
967101733 3:186221444-186221466 CTGATTTGGCGGAGGGTGGAGGG + Intronic
967991294 3:195133066-195133088 CTGCTTGGGGTGGAGGTGGTGGG + Intronic
968574077 4:1356923-1356945 CAGTTTTGTCTGAAGGTGGCCGG + Intronic
969502717 4:7563128-7563150 CTGCATTGGCTGGGGGTGAAGGG + Intronic
969630636 4:8333902-8333924 TTCTTTTGGCAGGAGGGGGAGGG - Intergenic
969745390 4:9066896-9066918 AAGTTTTTGCTGAAGGTGGATGG - Intergenic
970038171 4:11763774-11763796 CTCTTTTGTGTGGAGGTGGGGGG + Intergenic
971397910 4:26247412-26247434 TTTTTTTGGGTGGAGGGGGACGG + Intronic
971553611 4:27983531-27983553 CTGCTTTCACTGGAGGAGGATGG - Intergenic
973018800 4:45173181-45173203 CTGTCTTGGCTAGGGGTGGGGGG + Intergenic
976142968 4:82012097-82012119 CTGTTGGGGGTGGAGGTGGCAGG + Intronic
977259738 4:94784149-94784171 TTGTTTTGGCTGGAGAGGGTAGG + Intronic
977411107 4:96665318-96665340 CTACTTTTACTGGAGGTGGAGGG - Intergenic
980070684 4:128240550-128240572 CTGACTTGGCTGGAGGATGAAGG - Intergenic
980115572 4:128675859-128675881 TTGTTTTAACTGGAGTTGGAGGG - Intergenic
981177794 4:141702439-141702461 CTGCTTTGAATGGAGGTGGCAGG + Intronic
981601607 4:146495231-146495253 CTGCTTTGGCTTGTAGTGGAAGG - Intronic
982839471 4:160165263-160165285 CTGTTTTGACTGGAAATGGTAGG + Intergenic
984593189 4:181639369-181639391 CTGCCTTGGCTGCATGTGGATGG - Intergenic
985045595 4:185937691-185937713 TTATTTTAGCTGGAAGTGGAGGG + Intronic
985491536 5:182538-182560 TTGTCTTGGGTGGAAGTGGAAGG - Exonic
985725692 5:1514803-1514825 CTGTTTTGGCTGGAGGTGGAAGG - Intronic
986485870 5:8236353-8236375 CTGTTTTGGGGGAAGGAGGAGGG - Intergenic
986583804 5:9293790-9293812 ATGTTTAGGCTAGAGGTGGAGGG + Intronic
986816942 5:11422609-11422631 CTGGTTTGGCTGTAGCTGGCTGG - Intronic
986826085 5:11524254-11524276 CTGTTTTGTTAGGAGGTGAAAGG - Intronic
987233237 5:15916787-15916809 AACCTTTGGCTGGAGGTGGAGGG - Intronic
989194783 5:38706283-38706305 CTGTTGTGGGTGGAGAAGGAGGG - Intergenic
992212084 5:74490737-74490759 TTGTTTTGGCAGGGGGTGGGAGG - Intergenic
993955042 5:94221953-94221975 CTGTTTTGCCTGGAACTAGACGG - Intronic
994818862 5:104622257-104622279 CTCTGTTTGCTGGTGGTGGAAGG - Intergenic
995209796 5:109524684-109524706 CTGTTTTCTCTGCAGGAGGATGG - Intergenic
995932679 5:117468238-117468260 TTGTTTAGCCTGGAGGAGGATGG - Intergenic
996038489 5:118784718-118784740 ATGTTTTGACTGGAGGAAGATGG - Intergenic
996759455 5:126972644-126972666 CTGTTGGGGGTGGAAGTGGATGG - Intronic
999659071 5:153839957-153839979 ATGTTTTGGCTGGATGTGGTGGG - Intergenic
1000346218 5:160316236-160316258 TTGTCTTGGTTGGGGGTGGATGG - Intronic
1001710504 5:173774286-173774308 CTGGTTTGGCTGGAGGGCAATGG + Intergenic
1002962025 6:1924250-1924272 CTTTTTTGTGTGGAGGTGGCAGG - Intronic
1003060326 6:2857753-2857775 CTGTCATGGCATGAGGTGGAGGG - Intergenic
1003368086 6:5496142-5496164 TTTTTTTGGTTGGGGGTGGAAGG + Intronic
1003644519 6:7903749-7903771 CTGTTTCTGAAGGAGGTGGAGGG - Intronic
1004313401 6:14565477-14565499 CTGTTTTGGCTGGGGGTGGTAGG - Intergenic
1004516744 6:16327489-16327511 CTGGTGGGGGTGGAGGTGGACGG + Exonic
1005017489 6:21387880-21387902 CTGTTGAGGCTGCAGGTGAAAGG + Intergenic
1005142472 6:22649302-22649324 CTTTTTTGGCGGGGGGTGGGGGG - Intergenic
1006664231 6:35678227-35678249 GTGTTTTGGCTGGAGGGAGTGGG + Intronic
1008460293 6:51761422-51761444 CTGGTTTGGCTGGTGGTGGGGGG + Intronic
1010986520 6:82431424-82431446 GTGTTTTGGTGGGAAGTGGAAGG + Intergenic
1011334927 6:86249971-86249993 CAGTTATGGCAGAAGGTGGAGGG - Intergenic
1011456022 6:87550177-87550199 TTCTTTTGGCTGGAAATGGAAGG - Intronic
1012367113 6:98455077-98455099 CTGTTTTCACTGGAGGGGAAAGG + Intergenic
1015123775 6:129729517-129729539 TAGTTCTGGCTGGAGGTGGATGG - Intergenic
1015759623 6:136644563-136644585 CTGTATTGACTGAAGGTGGCAGG + Intronic
1016605245 6:145914157-145914179 CTGAGTTGGCTGGGGTTGGATGG + Intronic
1017715843 6:157212420-157212442 CTGGTGGGGCTGGAGGTGGGAGG + Intergenic
1018240305 6:161767750-161767772 CTGTCCTGGCTGGGGGTGGGGGG + Intronic
1018731005 6:166650429-166650451 CACTTTAGGCTGGAGGTGGGAGG + Intronic
1019798933 7:3073398-3073420 GTGATTTGGCGGGAGCTGGATGG + Intergenic
1020205201 7:6109163-6109185 GTGAACTGGCTGGAGGTGGAAGG + Intronic
1020606527 7:10344987-10345009 CTGTTTTGCCTGATGGTGGAAGG - Intergenic
1022221294 7:28316209-28316231 TGGTTTGGGCTGGGGGTGGAGGG + Intronic
1022429900 7:30307344-30307366 TTTTTTTGGCTGGGGGTGGAGGG + Intronic
1022454300 7:30545187-30545209 CTGTTGTGGCTGTAGCTGGGAGG - Intronic
1022474812 7:30702784-30702806 TTCCTTTGCCTGGAGGTGGAAGG + Intronic
1028111524 7:86948115-86948137 CTGTTTTGGCTGGAAGAGGGTGG - Intronic
1028661645 7:93283981-93284003 CTGTCTTGGCTGGAAGTGGAGGG + Intronic
1028910990 7:96207382-96207404 CTGTTCTGGGTAGAGGTGGAGGG - Intronic
1030105239 7:105981776-105981798 CAGATTTGGGTGGGGGTGGAGGG - Intronic
1030547639 7:110917576-110917598 CTATTTTTGCTGGAGGAGCATGG - Intronic
1030713903 7:112787374-112787396 CTTTTTTGGGGGGAGGGGGAAGG + Intronic
1031006369 7:116477060-116477082 ATGTTTTGACTGGGGGTGAAAGG + Intronic
1031888241 7:127263069-127263091 CTGTTTTAGCAGCATGTGGAGGG + Intergenic
1033212814 7:139472850-139472872 ATCTTTGGGCTGGGGGTGGAGGG - Intronic
1034577088 7:152009693-152009715 ATGGTTGGGCTGCAGGTGGAAGG - Intronic
1035575559 8:702513-702535 CCGTCTTGGCTGGAGGTGGGAGG - Intronic
1038083434 8:24166041-24166063 CAGTTTTTCCTGAAGGTGGAGGG + Intergenic
1038745889 8:30254387-30254409 CTGATCTGACAGGAGGTGGATGG + Intergenic
1039572751 8:38600624-38600646 CTCCTCTGGCTGGAGGTGGGCGG + Intergenic
1039843798 8:41311454-41311476 CGCATTTGGCTTGAGGTGGAGGG - Intergenic
1040057152 8:43069118-43069140 TTTTTTTGGGTGGGGGTGGATGG + Intronic
1042109679 8:65367485-65367507 CTGCTTGGGCAAGAGGTGGAGGG - Intergenic
1042981647 8:74536253-74536275 CTGTTGGGGGTGGAGGTGGTGGG - Intergenic
1044434930 8:92150821-92150843 CTGTCTGGGGTGGGGGTGGAGGG + Intergenic
1044668359 8:94653854-94653876 CCTTGTTAGCTGGAGGTGGAAGG + Intronic
1045402785 8:101835342-101835364 CTGGTTTGGCAGAAGGTGGAGGG - Intronic
1048833919 8:138500384-138500406 CTGGTTCTGCTGCAGGTGGAAGG + Intergenic
1049183106 8:141233508-141233530 CTATTTTTGCTGCAGGTGGTGGG - Intronic
1049264075 8:141657510-141657532 TTATTTTCTCTGGAGGTGGAAGG - Intergenic
1049499342 8:142953268-142953290 CTGCTTTGGTTGAAGGTGGTTGG - Intergenic
1054870957 9:70046650-70046672 CTGTTTTCCCTGAAGGGGGATGG - Intronic
1056978026 9:91278701-91278723 CTATCTTGGCTGGAAGAGGAAGG - Intronic
1057338224 9:94174436-94174458 CTGCTTTACCTGGAGGTTGAGGG + Intergenic
1059081830 9:111258082-111258104 CAGTTAAGGCAGGAGGTGGAAGG + Intergenic
1059403042 9:114082401-114082423 CTCTTTGGGTTGGAGGTGTAGGG - Intergenic
1059954227 9:119499160-119499182 ATGTTTTGGCAGGGGTTGGAGGG + Intronic
1060828752 9:126700939-126700961 CTGTTGTGGGAAGAGGTGGAAGG - Exonic
1061127168 9:128684324-128684346 GGGATTTGGCTGGATGTGGAGGG - Intronic
1061660857 9:132129468-132129490 CTGCTGTGGCTAGAGCTGGAGGG + Intergenic
1062098903 9:134717840-134717862 CTGTTTCGGTTGGACGAGGAGGG + Intronic
1185877472 X:3712805-3712827 CTGTGTGTGCTGGGGGTGGAGGG + Intronic
1185894024 X:3843052-3843074 CTGTGTGTGCTGGGGGTGGAGGG + Intronic
1185899142 X:3881476-3881498 CTGTGTGTGCTGGGGGTGGAGGG + Intergenic
1185904259 X:3919905-3919927 CTGTGTGTGCTGGGGGTGGAGGG + Intergenic
1187528053 X:20071806-20071828 TTGTTTTCCGTGGAGGTGGAAGG + Intronic
1189606892 X:42688067-42688089 CAATTTTGGCTGCAAGTGGAAGG - Intergenic
1190777899 X:53568806-53568828 CTGTAGAAGCTGGAGGTGGAGGG + Exonic
1193293853 X:79810076-79810098 CTGTTCTGCCTGGGGTTGGATGG + Intergenic
1193559400 X:82999146-82999168 CTGGCTTGGCTGGAGGTACAAGG - Intergenic
1195311150 X:103633204-103633226 GTGCTTAGGCAGGAGGTGGAAGG + Intergenic
1195314592 X:103665545-103665567 GTGCTTAGGCAGGAGGTGGAAGG + Intergenic
1195671336 X:107472694-107472716 CTGTTTTGCCTGGGGCTGGCTGG - Intergenic
1195875223 X:109534096-109534118 CTATGTTGGATGGAGGGGGAGGG - Intergenic
1196050064 X:111295552-111295574 TTGTTTTGGCTGGATGGGGGTGG - Exonic
1197869389 X:131050982-131051004 TTGCTGTGGGTGGAGGTGGATGG - Intergenic
1198136469 X:133756270-133756292 ATGTATTGGCTGTAGGTCGAAGG - Intronic
1199051123 X:143238339-143238361 CTGTTTGGGGTGGTCGTGGAGGG - Intergenic
1200060760 X:153482727-153482749 CTGTTGACGCTGGAGGTGGAAGG + Intronic