ID: 985728265

View in Genome Browser
Species Human (GRCh38)
Location 5:1526855-1526877
Sequence CCTTCTCTGCTGCAGCTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985728260_985728265 -1 Left 985728260 5:1526833-1526855 CCTGGGGCCCGGAGCGGGGACTC No data
Right 985728265 5:1526855-1526877 CCTTCTCTGCTGCAGCTGGAAGG No data
985728261_985728265 -8 Left 985728261 5:1526840-1526862 CCCGGAGCGGGGACTCCTTCTCT No data
Right 985728265 5:1526855-1526877 CCTTCTCTGCTGCAGCTGGAAGG No data
985728262_985728265 -9 Left 985728262 5:1526841-1526863 CCGGAGCGGGGACTCCTTCTCTG No data
Right 985728265 5:1526855-1526877 CCTTCTCTGCTGCAGCTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985728265 Original CRISPR CCTTCTCTGCTGCAGCTGGA AGG Intergenic
No off target data available for this crispr