ID: 985728343

View in Genome Browser
Species Human (GRCh38)
Location 5:1527229-1527251
Sequence GGGGCTCCCTTTGTAGCTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985728343_985728345 -7 Left 985728343 5:1527229-1527251 CCTTTAGCTACAAAGGGAGCCCC No data
Right 985728345 5:1527245-1527267 GAGCCCCCACTGTGGTTCTCAGG No data
985728343_985728350 3 Left 985728343 5:1527229-1527251 CCTTTAGCTACAAAGGGAGCCCC No data
Right 985728350 5:1527255-1527277 TGTGGTTCTCAGGAACCTCCTGG No data
985728343_985728354 25 Left 985728343 5:1527229-1527251 CCTTTAGCTACAAAGGGAGCCCC No data
Right 985728354 5:1527277-1527299 GAAGCCCCCCACAGCTCCCTGGG No data
985728343_985728358 30 Left 985728343 5:1527229-1527251 CCTTTAGCTACAAAGGGAGCCCC No data
Right 985728358 5:1527282-1527304 CCCCCACAGCTCCCTGGGGCTGG No data
985728343_985728355 26 Left 985728343 5:1527229-1527251 CCTTTAGCTACAAAGGGAGCCCC No data
Right 985728355 5:1527278-1527300 AAGCCCCCCACAGCTCCCTGGGG No data
985728343_985728353 24 Left 985728343 5:1527229-1527251 CCTTTAGCTACAAAGGGAGCCCC No data
Right 985728353 5:1527276-1527298 GGAAGCCCCCCACAGCTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985728343 Original CRISPR GGGGCTCCCTTTGTAGCTAA AGG (reversed) Intergenic