ID: 985728347

View in Genome Browser
Species Human (GRCh38)
Location 5:1527249-1527271
Sequence GGTTCCTGAGAACCACAGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985728347_985728364 27 Left 985728347 5:1527249-1527271 CCCCACTGTGGTTCTCAGGAACC No data
Right 985728364 5:1527299-1527321 GGCTGGTAACCACACCCCTGAGG No data
985728347_985728353 4 Left 985728347 5:1527249-1527271 CCCCACTGTGGTTCTCAGGAACC No data
Right 985728353 5:1527276-1527298 GGAAGCCCCCCACAGCTCCCTGG No data
985728347_985728354 5 Left 985728347 5:1527249-1527271 CCCCACTGTGGTTCTCAGGAACC No data
Right 985728354 5:1527277-1527299 GAAGCCCCCCACAGCTCCCTGGG No data
985728347_985728355 6 Left 985728347 5:1527249-1527271 CCCCACTGTGGTTCTCAGGAACC No data
Right 985728355 5:1527278-1527300 AAGCCCCCCACAGCTCCCTGGGG No data
985728347_985728358 10 Left 985728347 5:1527249-1527271 CCCCACTGTGGTTCTCAGGAACC No data
Right 985728358 5:1527282-1527304 CCCCCACAGCTCCCTGGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985728347 Original CRISPR GGTTCCTGAGAACCACAGTG GGG (reversed) Intergenic