ID: 985728349

View in Genome Browser
Species Human (GRCh38)
Location 5:1527251-1527273
Sequence GAGGTTCCTGAGAACCACAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985728349_985728355 4 Left 985728349 5:1527251-1527273 CCACTGTGGTTCTCAGGAACCTC No data
Right 985728355 5:1527278-1527300 AAGCCCCCCACAGCTCCCTGGGG No data
985728349_985728354 3 Left 985728349 5:1527251-1527273 CCACTGTGGTTCTCAGGAACCTC No data
Right 985728354 5:1527277-1527299 GAAGCCCCCCACAGCTCCCTGGG No data
985728349_985728358 8 Left 985728349 5:1527251-1527273 CCACTGTGGTTCTCAGGAACCTC No data
Right 985728358 5:1527282-1527304 CCCCCACAGCTCCCTGGGGCTGG No data
985728349_985728353 2 Left 985728349 5:1527251-1527273 CCACTGTGGTTCTCAGGAACCTC No data
Right 985728353 5:1527276-1527298 GGAAGCCCCCCACAGCTCCCTGG No data
985728349_985728364 25 Left 985728349 5:1527251-1527273 CCACTGTGGTTCTCAGGAACCTC No data
Right 985728364 5:1527299-1527321 GGCTGGTAACCACACCCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985728349 Original CRISPR GAGGTTCCTGAGAACCACAG TGG (reversed) Intergenic