ID: 985728358

View in Genome Browser
Species Human (GRCh38)
Location 5:1527282-1527304
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985728347_985728358 10 Left 985728347 5:1527249-1527271 CCCCACTGTGGTTCTCAGGAACC No data
Right 985728358 5:1527282-1527304 CCCCCACAGCTCCCTGGGGCTGG No data
985728349_985728358 8 Left 985728349 5:1527251-1527273 CCACTGTGGTTCTCAGGAACCTC No data
Right 985728358 5:1527282-1527304 CCCCCACAGCTCCCTGGGGCTGG No data
985728348_985728358 9 Left 985728348 5:1527250-1527272 CCCACTGTGGTTCTCAGGAACCT No data
Right 985728358 5:1527282-1527304 CCCCCACAGCTCCCTGGGGCTGG No data
985728343_985728358 30 Left 985728343 5:1527229-1527251 CCTTTAGCTACAAAGGGAGCCCC No data
Right 985728358 5:1527282-1527304 CCCCCACAGCTCCCTGGGGCTGG No data
985728346_985728358 11 Left 985728346 5:1527248-1527270 CCCCCACTGTGGTTCTCAGGAAC No data
Right 985728358 5:1527282-1527304 CCCCCACAGCTCCCTGGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type