ID: 985730707

View in Genome Browser
Species Human (GRCh38)
Location 5:1546719-1546741
Sequence CCTGCTTTGCAGAGGATGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985730707_985730720 19 Left 985730707 5:1546719-1546741 CCTTCCATCCTCTGCAAAGCAGG No data
Right 985730720 5:1546761-1546783 GTAGGACCGTGGAGTCTGGAGGG 0: 1
1: 0
2: 1
3: 2
4: 103
985730707_985730717 15 Left 985730707 5:1546719-1546741 CCTTCCATCCTCTGCAAAGCAGG No data
Right 985730717 5:1546757-1546779 ACCTGTAGGACCGTGGAGTCTGG 0: 1
1: 0
2: 0
3: 4
4: 77
985730707_985730715 1 Left 985730707 5:1546719-1546741 CCTTCCATCCTCTGCAAAGCAGG No data
Right 985730715 5:1546743-1546765 GCGAGGTGGAACTTACCTGTAGG 0: 1
1: 0
2: 0
3: 6
4: 108
985730707_985730716 8 Left 985730707 5:1546719-1546741 CCTTCCATCCTCTGCAAAGCAGG No data
Right 985730716 5:1546750-1546772 GGAACTTACCTGTAGGACCGTGG 0: 1
1: 0
2: 0
3: 2
4: 33
985730707_985730719 18 Left 985730707 5:1546719-1546741 CCTTCCATCCTCTGCAAAGCAGG No data
Right 985730719 5:1546760-1546782 TGTAGGACCGTGGAGTCTGGAGG 0: 1
1: 0
2: 1
3: 3
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985730707 Original CRISPR CCTGCTTTGCAGAGGATGGA AGG (reversed) Intergenic
No off target data available for this crispr