ID: 985731034

View in Genome Browser
Species Human (GRCh38)
Location 5:1549057-1549079
Sequence CGGAAGACTCCAGGGCAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985731034_985731042 8 Left 985731034 5:1549057-1549079 CCATCCTGCCCTGGAGTCTTCCG No data
Right 985731042 5:1549088-1549110 GTTGCCTTGAGCAGGCAGAAAGG No data
985731034_985731040 0 Left 985731034 5:1549057-1549079 CCATCCTGCCCTGGAGTCTTCCG No data
Right 985731040 5:1549080-1549102 CAGCCACGGTTGCCTTGAGCAGG No data
985731034_985731044 26 Left 985731034 5:1549057-1549079 CCATCCTGCCCTGGAGTCTTCCG No data
Right 985731044 5:1549106-1549128 AAAGGAGAAATATCTGAAAATGG No data
985731034_985731045 27 Left 985731034 5:1549057-1549079 CCATCCTGCCCTGGAGTCTTCCG No data
Right 985731045 5:1549107-1549129 AAGGAGAAATATCTGAAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985731034 Original CRISPR CGGAAGACTCCAGGGCAGGA TGG (reversed) Intergenic