ID: 985731035

View in Genome Browser
Species Human (GRCh38)
Location 5:1549061-1549083
Sequence GCTGCGGAAGACTCCAGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985731035_985731040 -4 Left 985731035 5:1549061-1549083 CCTGCCCTGGAGTCTTCCGCAGC No data
Right 985731040 5:1549080-1549102 CAGCCACGGTTGCCTTGAGCAGG No data
985731035_985731044 22 Left 985731035 5:1549061-1549083 CCTGCCCTGGAGTCTTCCGCAGC No data
Right 985731044 5:1549106-1549128 AAAGGAGAAATATCTGAAAATGG No data
985731035_985731042 4 Left 985731035 5:1549061-1549083 CCTGCCCTGGAGTCTTCCGCAGC No data
Right 985731042 5:1549088-1549110 GTTGCCTTGAGCAGGCAGAAAGG No data
985731035_985731045 23 Left 985731035 5:1549061-1549083 CCTGCCCTGGAGTCTTCCGCAGC No data
Right 985731045 5:1549107-1549129 AAGGAGAAATATCTGAAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985731035 Original CRISPR GCTGCGGAAGACTCCAGGGC AGG (reversed) Intergenic