ID: 985731036

View in Genome Browser
Species Human (GRCh38)
Location 5:1549065-1549087
Sequence CGTGGCTGCGGAAGACTCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985731036_985731044 18 Left 985731036 5:1549065-1549087 CCCTGGAGTCTTCCGCAGCCACG No data
Right 985731044 5:1549106-1549128 AAAGGAGAAATATCTGAAAATGG No data
985731036_985731045 19 Left 985731036 5:1549065-1549087 CCCTGGAGTCTTCCGCAGCCACG No data
Right 985731045 5:1549107-1549129 AAGGAGAAATATCTGAAAATGGG No data
985731036_985731040 -8 Left 985731036 5:1549065-1549087 CCCTGGAGTCTTCCGCAGCCACG No data
Right 985731040 5:1549080-1549102 CAGCCACGGTTGCCTTGAGCAGG No data
985731036_985731042 0 Left 985731036 5:1549065-1549087 CCCTGGAGTCTTCCGCAGCCACG No data
Right 985731042 5:1549088-1549110 GTTGCCTTGAGCAGGCAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985731036 Original CRISPR CGTGGCTGCGGAAGACTCCA GGG (reversed) Intergenic