ID: 985731039

View in Genome Browser
Species Human (GRCh38)
Location 5:1549077-1549099
Sequence GCTCAAGGCAACCGTGGCTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985731039_985731044 6 Left 985731039 5:1549077-1549099 CCGCAGCCACGGTTGCCTTGAGC No data
Right 985731044 5:1549106-1549128 AAAGGAGAAATATCTGAAAATGG No data
985731039_985731045 7 Left 985731039 5:1549077-1549099 CCGCAGCCACGGTTGCCTTGAGC No data
Right 985731045 5:1549107-1549129 AAGGAGAAATATCTGAAAATGGG No data
985731039_985731046 21 Left 985731039 5:1549077-1549099 CCGCAGCCACGGTTGCCTTGAGC No data
Right 985731046 5:1549121-1549143 GAAAATGGGACTCCTTGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985731039 Original CRISPR GCTCAAGGCAACCGTGGCTG CGG (reversed) Intergenic