ID: 985731040

View in Genome Browser
Species Human (GRCh38)
Location 5:1549080-1549102
Sequence CAGCCACGGTTGCCTTGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985731034_985731040 0 Left 985731034 5:1549057-1549079 CCATCCTGCCCTGGAGTCTTCCG No data
Right 985731040 5:1549080-1549102 CAGCCACGGTTGCCTTGAGCAGG No data
985731035_985731040 -4 Left 985731035 5:1549061-1549083 CCTGCCCTGGAGTCTTCCGCAGC No data
Right 985731040 5:1549080-1549102 CAGCCACGGTTGCCTTGAGCAGG No data
985731037_985731040 -9 Left 985731037 5:1549066-1549088 CCTGGAGTCTTCCGCAGCCACGG No data
Right 985731040 5:1549080-1549102 CAGCCACGGTTGCCTTGAGCAGG No data
985731036_985731040 -8 Left 985731036 5:1549065-1549087 CCCTGGAGTCTTCCGCAGCCACG No data
Right 985731040 5:1549080-1549102 CAGCCACGGTTGCCTTGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985731040 Original CRISPR CAGCCACGGTTGCCTTGAGC AGG Intergenic