ID: 985731041

View in Genome Browser
Species Human (GRCh38)
Location 5:1549083-1549105
Sequence CTGCCTGCTCAAGGCAACCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985731041_985731045 1 Left 985731041 5:1549083-1549105 CCACGGTTGCCTTGAGCAGGCAG No data
Right 985731045 5:1549107-1549129 AAGGAGAAATATCTGAAAATGGG No data
985731041_985731044 0 Left 985731041 5:1549083-1549105 CCACGGTTGCCTTGAGCAGGCAG No data
Right 985731044 5:1549106-1549128 AAAGGAGAAATATCTGAAAATGG No data
985731041_985731046 15 Left 985731041 5:1549083-1549105 CCACGGTTGCCTTGAGCAGGCAG No data
Right 985731046 5:1549121-1549143 GAAAATGGGACTCCTTGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985731041 Original CRISPR CTGCCTGCTCAAGGCAACCG TGG (reversed) Intergenic