ID: 985731043

View in Genome Browser
Species Human (GRCh38)
Location 5:1549092-1549114
Sequence TTCTCCTTTCTGCCTGCTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985731043_985731046 6 Left 985731043 5:1549092-1549114 CCTTGAGCAGGCAGAAAGGAGAA No data
Right 985731046 5:1549121-1549143 GAAAATGGGACTCCTTGTGCAGG No data
985731043_985731049 26 Left 985731043 5:1549092-1549114 CCTTGAGCAGGCAGAAAGGAGAA No data
Right 985731049 5:1549141-1549163 AGGAACCCACATTTGCAAATGGG No data
985731043_985731048 25 Left 985731043 5:1549092-1549114 CCTTGAGCAGGCAGAAAGGAGAA No data
Right 985731048 5:1549140-1549162 CAGGAACCCACATTTGCAAATGG No data
985731043_985731044 -9 Left 985731043 5:1549092-1549114 CCTTGAGCAGGCAGAAAGGAGAA No data
Right 985731044 5:1549106-1549128 AAAGGAGAAATATCTGAAAATGG No data
985731043_985731045 -8 Left 985731043 5:1549092-1549114 CCTTGAGCAGGCAGAAAGGAGAA No data
Right 985731045 5:1549107-1549129 AAGGAGAAATATCTGAAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985731043 Original CRISPR TTCTCCTTTCTGCCTGCTCA AGG (reversed) Intergenic