ID: 985731044

View in Genome Browser
Species Human (GRCh38)
Location 5:1549106-1549128
Sequence AAAGGAGAAATATCTGAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985731034_985731044 26 Left 985731034 5:1549057-1549079 CCATCCTGCCCTGGAGTCTTCCG No data
Right 985731044 5:1549106-1549128 AAAGGAGAAATATCTGAAAATGG No data
985731039_985731044 6 Left 985731039 5:1549077-1549099 CCGCAGCCACGGTTGCCTTGAGC No data
Right 985731044 5:1549106-1549128 AAAGGAGAAATATCTGAAAATGG No data
985731041_985731044 0 Left 985731041 5:1549083-1549105 CCACGGTTGCCTTGAGCAGGCAG No data
Right 985731044 5:1549106-1549128 AAAGGAGAAATATCTGAAAATGG No data
985731043_985731044 -9 Left 985731043 5:1549092-1549114 CCTTGAGCAGGCAGAAAGGAGAA No data
Right 985731044 5:1549106-1549128 AAAGGAGAAATATCTGAAAATGG No data
985731036_985731044 18 Left 985731036 5:1549065-1549087 CCCTGGAGTCTTCCGCAGCCACG No data
Right 985731044 5:1549106-1549128 AAAGGAGAAATATCTGAAAATGG No data
985731035_985731044 22 Left 985731035 5:1549061-1549083 CCTGCCCTGGAGTCTTCCGCAGC No data
Right 985731044 5:1549106-1549128 AAAGGAGAAATATCTGAAAATGG No data
985731037_985731044 17 Left 985731037 5:1549066-1549088 CCTGGAGTCTTCCGCAGCCACGG No data
Right 985731044 5:1549106-1549128 AAAGGAGAAATATCTGAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985731044 Original CRISPR AAAGGAGAAATATCTGAAAA TGG Intergenic