ID: 985734268

View in Genome Browser
Species Human (GRCh38)
Location 5:1568923-1568945
Sequence TGGGGGCCTCAGCACTAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985734268_985734275 23 Left 985734268 5:1568923-1568945 CCTTCCTAGTGCTGAGGCCCCCA No data
Right 985734275 5:1568969-1568991 GTGTGTGATGTGTTGTTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985734268 Original CRISPR TGGGGGCCTCAGCACTAGGA AGG (reversed) Intergenic
No off target data available for this crispr