ID: 985734965

View in Genome Browser
Species Human (GRCh38)
Location 5:1574185-1574207
Sequence CCTATGTGGACGTTGGCACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985734965_985734977 30 Left 985734965 5:1574185-1574207 CCCAGTGCCAACGTCCACATAGG No data
Right 985734977 5:1574238-1574260 AGGGCTTCTTCTGTTGCCCCTGG No data
985734965_985734973 11 Left 985734965 5:1574185-1574207 CCCAGTGCCAACGTCCACATAGG No data
Right 985734973 5:1574219-1574241 TTCCTCCAGTGCTCCTCAAAGGG No data
985734965_985734972 10 Left 985734965 5:1574185-1574207 CCCAGTGCCAACGTCCACATAGG No data
Right 985734972 5:1574218-1574240 CTTCCTCCAGTGCTCCTCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985734965 Original CRISPR CCTATGTGGACGTTGGCACT GGG (reversed) Intergenic
No off target data available for this crispr